ABCB5 (NM_001163993) Human Untagged Clone
CAT#: SC326700
ABCB5 (untagged)-Human ATP-binding cassette sub-family B (MDR/TAP) member 5 (ABCB5) transcript variant 4
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ABCB5alpha; ABCB5beta; EST422562 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC326700 representing NM_001163993.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTGGATGAGAATGACATCAGAGCTTTAAATGTGCGGCATTATCGAGACCATATTGGAGTGGTTAGT CAAGAGCCTGTTTTGTTCGGGACCACCATCAGTAACAATATCAAGTATGGACGAGATGATGTGACTGAT GAAGAGATGGAGAGAGCAGCAAGGGAAGCAAATGCGTATGATTTTATCATGGAGTTTCCTAATAAATTT AATACATTGGTAGGGGAAAAAGGAGCTCAAATGAGTGGAGGGCAGAAACAGAGGATCGCAATTGCTCGT GCCTTAGTTCGAAACCCCAAGATTCTGATTTTAGATGAGGCTACGTCTGCCCTGGATTCAGAAAGCAAG TCAGCTGTTCAAGCTGCACTGGAGAAGAAAAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001163993 |
Insert Size | 381 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001163993.2 |
RefSeq Size | 1724 bp |
RefSeq ORF | 381 bp |
Locus ID | 340273 |
UniProt ID | Q2M3G0 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | ABC transporters |
MW | 14.1 kDa |
Gene Summary | ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (4) differs in the 5' and 3' UTRs and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (4) with a shorter N-terminus and a shorter and distinct C-terminus, compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228065 | ABCB5 (Myc-DDK-tagged)-Human ATP-binding cassette, sub-family B (MDR/TAP), member 5 (ABCB5), transcript variant 4 |
CNY 1,800.00 |
|
RC228065L3 | Lenti-ORF clone of ABCB5 (Myc-DDK-tagged)-Human ATP-binding cassette, sub-family B (MDR/TAP), member 5 (ABCB5), transcript variant 4 |
CNY 5,890.00 |
|
RC228065L4 | Lenti-ORF clone of ABCB5 (mGFP-tagged)-Human ATP-binding cassette, sub-family B (MDR/TAP), member 5 (ABCB5), transcript variant 4 |
CNY 5,890.00 |
|
RG228065 | ABCB5 (tGFP-tagged) - Human ATP-binding cassette, sub-family B (MDR/TAP), member 5 (ABCB5), transcript variant 4 |
CNY 3,400.00 |