DAOA (NM_001161812) Human Untagged Clone
CAT#: SC326698
DAOA (untagged)-Human D-amino acid oxidase activator (DAOA) transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LG72; SG72 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001161812, the custom clone sequence may differ by one or more nucleotides
ATGAGGACGGCTATTTGGAAATGGCACAGAGGCATTTACAGAGATCATTATGTCCTTGGG TCTCTTACCTTCCTCAGCCCTATGCAGAGAGCTGGGACTTCTAACCAATGGAACATGGGA AAGGTGATGACACTTGACTCCGGTGATGAGGTTACCTTTCACAAGACCTGGCCAACTGAG ACCGGATCTCCTTACAGGCTTGAAGAAGTAAGCAGCCATGTTGGAAAAGTCTTCATGGCA AGAAACTATGAGTTCCTTGCCTATGAGGCCTCTAAGGACCGCAGGCAGCCTCTAGAACGA ATGTGGACCTGCAACTACAACCAGCAAAAAGACCAGTCATGCAACCACAAGGAAATAACT TCTACCAAAGCTGAA |
Restriction Sites | Please inquire |
ACCN | NM_001161812 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001161812.1, NP_001155284.1 |
RefSeq Size | 924 bp |
RefSeq ORF | 378 bp |
Locus ID | 267012 |
UniProt ID | P59103 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a protein that may function as an activator of D-amino acid oxidase, which degrades the gliotransmitter D-serine, a potent activator of N-methyl-D-aspartate (NMDA) type glutamate receptors. Studies also suggest that one encoded isoform may play a role in mitochondrial function and dendritic arborization. Polymorphisms in this gene have been implicated in susceptibility to schizophrenia and bipolar affective disorder. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Mar 2011] Transcript Variant: This variant (2) has additional segments in the 5' and 3' coding regions, as compared to variant 1, which results in a downstream AUG start codon. The resulting isoform (2) is shorter and has a different N-terminus, as compared to isoform 1. CCDS Note: This CCDS ID represents the protein described in PMIDs: 12364586 and 14966479. This transcript is supported by AY170469.2. It should be noted this transcript is predicted to undergo nonsense-mediated mRNA decay (NMD). However, the protein is represented because it was detected endogenously in PMID: 18544534. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228063 | DAOA (Myc-DDK-tagged)-Human D-amino acid oxidase activator (DAOA), transcript variant 2 |
CNY 3,990.00 |
|
RC228063L3 | Lenti-ORF clone of DAOA (Myc-DDK-tagged)-Human D-amino acid oxidase activator (DAOA), transcript variant 2 |
CNY 5,890.00 |
|
RC228063L4 | Lenti-ORF clone of DAOA (mGFP-tagged)-Human D-amino acid oxidase activator (DAOA), transcript variant 2 |
CNY 5,890.00 |
|
RG228063 | DAOA (tGFP-tagged) - Human D-amino acid oxidase activator (DAOA), transcript variant 2 |
CNY 4,370.00 |