United States
Germany
Japan
United Kingdom
China
Lymphocyte Antigen 6 Complex (LY6K) (NM_001160355) Human Untagged Clone
CAT＃: SC326681
LY6K (untagged)-Human lymphocyte antigen 6 complex locus K (LY6K) transcript variant 3
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CT97; HSJ001348; ly-6K; URLC10 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001160355 edited
ATGAGGCTCCAAAGACCCCGACAGGCCCCGGCGGGTGGGAGGCGCGCGCCCCGGGGCGGG CGGGGCTCCCCCTACCGGCCAGACCCGGGGAGAGGCGCGCGGAGGCTGCGAAGGTTCCAG AAGGGCGGGGAGGGGGCGCCGCGCGCTGACCCTCCCTGGGCACCGCTGGGGACGATGGCG CTGCTCGCCTTGCTGCTGGTCGTGGCCCTACCGCGGGTGTGGACAGACGCCAACCTGACT GCGAGACAACGAGATCCAGAGGACTCCCAGCGAACGGACGAGGGTGACAATAGAGTGTGG TGTCATGTTTGTGAGAGAGAAAACACTTTCGAGTGCCAGAACCCAAGGAGGTGCAAATGG ACAGAGCCATACTGCGTTATAGCGGCCGTGACAGTGCTCCGCTGGTTGTGCAGCGATGGA GAGACCCAAGCCAGAGGAGAAGCGGTTTCTCCTGGAAGAGCCCATGCCCTTCTTTTACCT CAAGTGTTGTAAAATTCGCTACTGCAATTTAGAGGGGCCACCTATCAACTCATCAGTGTT CAAAGAATATGCTGGGAGCATGGGTGAGAGCTGTGGTGGGCTGTGGCTGGCCATCCTCCT GCTGCTGGCCTCCATTGCAGCCGGCCTCAGCCTGTCT |
| Restriction Sites | Please inquire |
| ACCN | NM_001160355 |
| Insert Size | 700 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001160355.1, NP_001153827.1 |
| RefSeq Size | 1715 bp |
| RefSeq ORF | 318 bp |
| Locus ID | 54742 |
| UniProt ID | Q17RY6 |
| Protein Families | Transmembrane |
| Gene Summary | Required for sperm migration into the oviduct and male fertility by controlling binding of sperm to zona pellucida (By similarity). May play a role in cell growth (PubMed:18089789).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region that causes a frameshift, compared to variant 1. The resulting isoform (3) has a distinct and shorter C-terminus, compared to isoform 1. Sequence Note: A downstream translational start codon is selected for this RefSeq based on its better conservation in mammalian species, on a strong Kozak signal, and on the presence of a predicted signal peptide in the protein N-terminus. Studies in PMID:18089789 support the secretion of this protein. An upstream in-frame start codon is also present but has a weaker Kozak signal and is poorly conserved. The use of the upstream start codon would result in a protein that lacks a predicted signal peptide and is 58 aa longer at the N-terminus. Leaky scanning by ribosomes may allow translation initiation at the downstream start codon. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228046 | LY6K (Myc-DDK-tagged)-Human lymphocyte antigen 6 complex, locus K (LY6K), transcript variant 3 |
CNY 3,990.00 |
|
| RC228046L3 | Lenti-ORF clone of LY6K (Myc-DDK-tagged)-Human lymphocyte antigen 6 complex, locus K (LY6K), transcript variant 3 |
CNY 5,890.00 |
|
| RC228046L4 | Lenti-ORF clone of LY6K (mGFP-tagged)-Human lymphocyte antigen 6 complex, locus K (LY6K), transcript variant 3 |
CNY 5,890.00 |
|
| RG228046 | LY6K (tGFP-tagged) - Human lymphocyte antigen 6 complex, locus K (LY6K), transcript variant 3 |
CNY 4,370.00 |
其它Lymphocyte Antigen 6 Complex产品
