United States
Germany
Japan
United Kingdom
China
Inositol Hexakisphosphate Kinase 2 (IP6K2) (NM_001146179) Human Untagged Clone
CAT＃: SC326667
IP6K2 (untagged)-Human inositol hexakisphosphate kinase 2 (IP6K2) transcript variant 6
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | IHPK2; InsP6K2; PIUS |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001146179, the custom clone sequence may differ by one or more nucleotides
ATGAGCCCAGCCTTCAGGGCCATGGATGTGGAGCCCCGCGCCAAAGGCGTCCTTCTGGAG CCCTTTGTCCACCAGGTCGGGGGGCACTCATGCGTGCTCCGCTTCAATGAGACAACCCTG TGCAAGCCCCTGGTCCCAAGGGAACATCAGTTCTACGAGACCCTCCCTGCTGAGATGCGC AAATTCACTCCCCAGTACAAAGGGGACATCAGCAGCCACCAGCATGGTGGGGTCTTTGTT GGGGAGTGGGGGAGTCTTTTG |
| Restriction Sites | Please inquire |
| ACCN | NM_001146179 |
| Insert Size | 1321 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001146179.1, NP_001139651.1 |
| RefSeq Size | 1321 bp |
| RefSeq ORF | 264 bp |
| Locus ID | 51447 |
| UniProt ID | Q9UHH9 |
| Protein Families | Druggable Genome |
| Gene Summary | This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4 and affect the growth suppressive and apoptotic activities of interferon-beta in some ovarian cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (6) uses an alternate in-frame splice site in the 5' UTR and differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (c) has a shorter and distinct C-terminus compared to isoform a. Variants 5 and 6 encode the same isoform (c). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228032 | IP6K2 (Myc-DDK-tagged)-Human inositol hexakisphosphate kinase 2 (IP6K2), transcript variant 6 |
CNY 3,990.00 |
|
| RC228032L3 | Lenti-ORF clone of IP6K2 (Myc-DDK-tagged)-Human inositol hexakisphosphate kinase 2 (IP6K2), transcript variant 6 |
CNY 5,890.00 |
|
| RC228032L4 | Lenti-ORF clone of IP6K2 (mGFP-tagged)-Human inositol hexakisphosphate kinase 2 (IP6K2), transcript variant 6 |
CNY 5,890.00 |
|
| RG228032 | IP6K2 (tGFP-tagged) - Human inositol hexakisphosphate kinase 2 (IP6K2), transcript variant 6 |
CNY 4,370.00 |
其它Inositol Hexakisphosphate Kinase 2产品
