ASXL1 (NM_001164603) Human Untagged Clone
CAT#: SC326665
ASXL1 (untagged)-Human additional sex combs like 1 (Drosophila) (ASXL1) transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BOPS; MDS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC326665 representing NM_001164603.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGGACAAACAGAAGAAGAAGAAGGAGCGCACGTGGGCCGAGGCCGCGCGCCTGGTATTAGAAAAC TACTCGGATGCTCCAATGACACCAAAACAGATTCTGCAGGTCATAGAGGCAGAAGGACTAAAGGAAATG AGAAGTGGGACTTCCCCTCTCGCATGCCTCAATGCTATGCTACATTCCAATTCAAGAGGAGGAGAGGGG TTGTTTTATAAACTGCCTGGCCGAATCAGCCTTTTCACGCTCAAGGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001164603 |
Insert Size | 258 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001164603.1 |
RefSeq Size | 1084 bp |
RefSeq ORF | 258 bp |
Locus ID | 171023 |
MW | 9.6 kDa |
Gene Summary | This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) differs in the 3' UTR and lacks several exons in the 3' coding region, but contains an alternate 3' exon, compared to variant 1. The encoded isoform (2) is significantly shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228030 | ASXL1 (Myc-DDK-tagged)-Human additional sex combs like 1 (Drosophila) (ASXL1), transcript variant 2 |
CNY 1,200.00 |
|
RC228030L1 | Lenti ORF clone of Human additional sex combs like 1 (Drosophila) (ASXL1), transcript variant 2, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC228030L2 | Lenti ORF clone of Human additional sex combs like 1 (Drosophila) (ASXL1), transcript variant 2, mGFP tagged |
CNY 3,600.00 |
|
RC228030L3 | Lenti ORF clone of Human additional sex combs like 1 (Drosophila) (ASXL1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC228030L4 | Lenti ORF clone of Human additional sex combs like 1 (Drosophila) (ASXL1), transcript variant 2, mGFP tagged |
CNY 3,600.00 |
|
RG228030 | ASXL1 (tGFP-tagged) - Human additional sex combs like 1 (Drosophila) (ASXL1), transcript variant 2 |
CNY 2,800.00 |