United States
Germany
Japan
United Kingdom
China
HRH4 (NM_001160166) Human Untagged Clone
CAT＃: SC326659
HRH4 (untagged)-Human histamine receptor H4 (HRH4) transcript variant 3
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AXOR35; BG26; GPCR105; GPRv53; H4; H4R; HH4R |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001160166, the custom clone sequence may differ by one or more nucleotides
ATGCCAGATACTAATAGCACAATCAATTTATCACTAAGCACTCGTGTTACTTTAGCATTT TTTATGTCCTTAGTAGCTTTTGCTATAATGCTAGGAAATGCTTTGGTCATTTTAGCTTTT GTGGTGGACAAAAACCTTAGACATCGAAGTAGTTATTTTTTTCTTAACTTGGCCATCTCT GACTTCTTTGTGGGTGTCTTA |
| Restriction Sites | Please inquire |
| ACCN | NM_001160166 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001160166.1, NP_001153638.1 |
| RefSeq Size | 3522 bp |
| RefSeq ORF | 204 bp |
| Locus ID | 59340 |
| UniProt ID | Q9H3N8 |
| Protein Families | Druggable Genome, GPCR, Transmembrane |
| Protein Pathways | Neuroactive ligand-receptor interaction |
| Gene Summary | Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by a family of histamine receptors, which are a subset of the G-protein coupled receptor superfamily. This gene encodes a histamine receptor that is predominantly expressed in haematopoietic cells. The protein is thought to play a role in inflammation and allergy reponses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009] Transcript Variant: This variant (3) lacks an alternate coding exon resulting in a frameshift, compared to variant 1. The resulting isoform (3), also known as H4R(67), has a substantially shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228024 | HRH4 (Myc-DDK-tagged)-Human histamine receptor H4 (HRH4), transcript variant 3 |
CNY 3,990.00 |
|
| RC228024L3 | Lenti-ORF clone of HRH4 (Myc-DDK-tagged)-Human histamine receptor H4 (HRH4), transcript variant 3 |
CNY 5,890.00 |
|
| RC228024L4 | Lenti-ORF clone of HRH4 (mGFP-tagged)-Human histamine receptor H4 (HRH4), transcript variant 3 |
CNY 5,890.00 |
|
| RG228024 | HRH4 (tGFP-tagged) - Human histamine receptor H4 (HRH4), transcript variant 3 |
CNY 4,370.00 |
