AFMID (NM_001145526) Human Untagged Clone

CAT#: SC326555

AFMID (untagged)-Human arylformamidase (AFMID), transcript variant 2, mRNA



  "NM_001145526" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FKF; KF; KFA
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001145526, the custom clone sequence may differ by one or more nucleotides
ATGATGGATGTGTCTGGTGTGGGTTTCCCAAGCAAGGTTCCTTGGAAGAAGATGTCTGCA
GAGGAGCTGGAGAATCAGTACTGTCCCAGCCGATGGGTTGTCCGACTGGGAGCAGAGGAA
GCCTTGAGGACCTACTCACAGATAGGAATTGAAGCCACCACAAGGGCCCGGGCCACCAGG
AAGAGCCTGCTGCATGTCCCCTATGGAGACGGCGAAGGGGAGAAAGTGGACATTTACTTC
CCCGACGAGTCGTCTGAAGCCTTGCCTTTCTTCCTGTTCTTTCACGGAGGATACTGGCAG
AGCGGAAGTAAGGATGAGTCTGCCTTCATGGTCCACCCGCTGACGGCACAGGGAGTGGCC
GTGGTAATAGTGGCTTACGGCATCGCCCCCAAAGGCACCCTGGACCACATGGTAGACCAG
GTGACCCGCAGCGTTGCGTTTGTCCAGAAGCGGTATCCAAGCAACAAGGGAATTTACCTG
TGTGGACACTCAGCCGGGGCCCACCTGGCTGCCATGATGCTCCTGGCCGACTGGACCAAG
CATGGGGTCACGCCCAACCTCAGAGGCTTTTTCCTGGTGAGTGGGGTCTTTGACCTGGAG
CCCATCGTGTATACTTCACAGAACGTTGCTCTCCAGCTGACCCTGGAGGACGCTCAGAGG
AATAGCCCCCAGCTGAAGGTGGCCCAGGCACAGCCGGTGGACCCCACCTGCCGTGTGCTG
GTGGTCGTGGGCCAGTTCGACTCCCCCGAATTCCACCGACAGTCCTGGGAGTTTTACCAG
GTACTCCCAGTGCAGACCCTGTGTCAAGGAGAGTGGAAAGCCTCATTTGAAGAGCTCCAC
GATGTGGACCACTTTGAAATTGTTGAGAATCTGACCCAGAAGGACAACGTGCTCACCCAG
ATTATCTTGAAAACAATCTTCCAG
Restriction Sites Please inquire     
ACCN NM_001145526
Insert Size 1770 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001145526.1, NP_001138998.1
RefSeq Size 1770 bp
RefSeq ORF 1770 bp
Locus ID 125061
UniProt ID Q63HM1
Protein Pathways Glyoxylate and dicarboxylate metabolism, Metabolic pathways, Tryptophan metabolism
Gene Summary Catalyzes the hydrolysis of N-formyl-L-kynurenine to L-kynurenine, the second step in the kynurenine pathway of tryptophan degradation. Kynurenine may be further oxidized to nicotinic acid, NAD(H) and NADP(H). Required for elimination of toxic metabolites.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...