AFMID (NM_001145526) Human Untagged Clone
CAT#: SC326555
AFMID (untagged)-Human arylformamidase (AFMID), transcript variant 2, mRNA
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FKF; KF; KFA |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001145526, the custom clone sequence may differ by one or more nucleotides
ATGATGGATGTGTCTGGTGTGGGTTTCCCAAGCAAGGTTCCTTGGAAGAAGATGTCTGCA GAGGAGCTGGAGAATCAGTACTGTCCCAGCCGATGGGTTGTCCGACTGGGAGCAGAGGAA GCCTTGAGGACCTACTCACAGATAGGAATTGAAGCCACCACAAGGGCCCGGGCCACCAGG AAGAGCCTGCTGCATGTCCCCTATGGAGACGGCGAAGGGGAGAAAGTGGACATTTACTTC CCCGACGAGTCGTCTGAAGCCTTGCCTTTCTTCCTGTTCTTTCACGGAGGATACTGGCAG AGCGGAAGTAAGGATGAGTCTGCCTTCATGGTCCACCCGCTGACGGCACAGGGAGTGGCC GTGGTAATAGTGGCTTACGGCATCGCCCCCAAAGGCACCCTGGACCACATGGTAGACCAG GTGACCCGCAGCGTTGCGTTTGTCCAGAAGCGGTATCCAAGCAACAAGGGAATTTACCTG TGTGGACACTCAGCCGGGGCCCACCTGGCTGCCATGATGCTCCTGGCCGACTGGACCAAG CATGGGGTCACGCCCAACCTCAGAGGCTTTTTCCTGGTGAGTGGGGTCTTTGACCTGGAG CCCATCGTGTATACTTCACAGAACGTTGCTCTCCAGCTGACCCTGGAGGACGCTCAGAGG AATAGCCCCCAGCTGAAGGTGGCCCAGGCACAGCCGGTGGACCCCACCTGCCGTGTGCTG GTGGTCGTGGGCCAGTTCGACTCCCCCGAATTCCACCGACAGTCCTGGGAGTTTTACCAG GTACTCCCAGTGCAGACCCTGTGTCAAGGAGAGTGGAAAGCCTCATTTGAAGAGCTCCAC GATGTGGACCACTTTGAAATTGTTGAGAATCTGACCCAGAAGGACAACGTGCTCACCCAG ATTATCTTGAAAACAATCTTCCAG |
Restriction Sites | Please inquire |
ACCN | NM_001145526 |
Insert Size | 1770 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145526.1, NP_001138998.1 |
RefSeq Size | 1770 bp |
RefSeq ORF | 1770 bp |
Locus ID | 125061 |
UniProt ID | Q63HM1 |
Protein Pathways | Glyoxylate and dicarboxylate metabolism, Metabolic pathways, Tryptophan metabolism |
Gene Summary | Catalyzes the hydrolysis of N-formyl-L-kynurenine to L-kynurenine, the second step in the kynurenine pathway of tryptophan degradation. Kynurenine may be further oxidized to nicotinic acid, NAD(H) and NADP(H). Required for elimination of toxic metabolites.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227526 | AFMID (Myc-DDK-tagged)-Human arylformamidase (AFMID), transcript variant 1 |
CNY 2,640.00 |
|
RC227526L3 | Lenti-ORF clone of AFMID (Myc-DDK-tagged)-Human arylformamidase (AFMID), transcript variant 1 |
CNY 5,890.00 |
|
RC227526L4 | Lenti-ORF clone of AFMID (mGFP-tagged)-Human arylformamidase (AFMID), transcript variant 1 |
CNY 5,890.00 |
|
RG227526 | AFMID (tGFP-tagged) - Human arylformamidase (AFMID), transcript variant 1 |
CNY 4,370.00 |