Troponin I fast skeletal muscle (TNNI2) (NM_001145841) Human Untagged Clone

CAT#: SC326535

TNNI2 (untagged)-Human troponin I type 2 (skeletal, fast) (TNNI2), transcript variant 3, mRNA



  "NM_001145841" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TNNI2 mouse monoclonal antibody, clone OTI3A11 (formerly 3A11), Biotinylated
    • 100 ul

CNY 3,990.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AMCD2B; DA2B; DA2B1; FSSV; fsTnI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326535 representing NM_001145841.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCCAGTGCAAGAAGCGGAACAGGGCCATCACGGCCCGCAGGCAGCACCTGAAGAGTGTGATGCTG
CAGATAGCGGCCACGGAGCTGGAGAAGGAGGAGAGCCGCCGTGAGGCAGAGAAGCAGAACTACCTGGCG
GAGCACTGCCCGCCGCTGCATATCCCGGGCTCCATGTCTGAAGTGCAGGAGCTCTGCAAACAGCTGCAC
GCCAAGATCGATGCGGCTGAAGAGGAGAAGTACGACATGGAGGTGAGGGTGCAGAAGACCAGCAAGGAG
CTGGAGGACATGAACCAGAAGCTATTTGATCTGCGGGGCAAGTTCAAGCGGCCCCCACTGCGGAGGGTG
CGCATGTCGGCCGATGCCATGCTCAAGGCCCTGCTGGGCTCGAAGCACAAGGTGTGCATGGACCTGAGG
GCCAACCTGAAGCAGGTCAAGAAGGAGGACACAGAGAAGGAGCGGGACCTGCGAGACGTGGGTGACTGG
AGGAAGAACATCGAGGAGAAGTCTGGCATGGAGGGCCGGAAGAAGATGTTTGAGTCCGAGTCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145841
Insert Size 549 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001145841.1
RefSeq Size 707 bp
RefSeq ORF 549 bp
Locus ID 7136
UniProt ID P48788
MW 21.4 kDa
Gene Summary This gene encodes a fast-twitch skeletal muscle protein, a member of the troponin I gene family, and a component of the troponin complex including troponin T, troponin C and troponin I subunits. The troponin complex, along with tropomyosin, is responsible for the calcium-dependent regulation of striated muscle contraction. Mouse studies show that this component is also present in vascular smooth muscle and may play a role in regulation of smooth muscle function. In addition to muscle tissues, this protein is found in corneal epithelium, cartilage where it is an inhibitor of angiogenesis to inhibit tumor growth and metastasis, and mammary gland where it functions as a co-activator of estrogen receptor-related receptor alpha. This protein also suppresses tumor growth in human ovarian carcinoma. Mutations in this gene cause myopathy and distal arthrogryposis type 2B. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
Transcript Variant: This variant (3) lacks a few of 5' exons, but has an alternate 5' exon, as compared to variant 1. The resulting isoform (2) is the same size but has a different N-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Troponin I fast skeletal muscle产品

Customer Reviews 
Loading...