PGAP2 (NM_001145439) Human Untagged Clone
CAT#: SC326530
PGAP2 (untagged)-Human FGF receptor activating protein 1 (FRAG1), transcript variant 3, mRNA
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CWH43-N; FLJ26520; FRAG1; MGC799 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC326530 representing NM_001145439.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTAGATGGAACGCAGCTGAGAGGTGCCCAATTACCTGCCCTCGGTGAGCTCAGCCATCGGCGGGGA GGTGCCCCAGCGCTACGTGTGGCGTTTCTGCATCGGCCTGCACTCGGCGCCTCGCTTCTTGGTGGCCTT CGCCTACTGGAACCACTACCTCAGCTGCACCTCCCCGTGTTCCTGCTATCGCCCGCTCTGCCGCCTCAA CTTCGGCCTCAATGTCGTGGAGAACCTCGCGTTGCTAGTGCTCACTTATGTCTCCTCCTCCGAGGACTT CACCATCCACGAAAATGCTTTCATTGTGTTCATTGCCTCATCCCTCGGGCACATGCTCCTCACCTGCAT TCTCTGGCGGTTGACCAAGAAGCACACAGTAAGTCAGGAGGATCGCAAGTCCTACAGCTGGAAACAGCG GCTCTTCATCATCAACTTCATCTCCTTCTTCTCGGCGCTGGCTGTCTACTTTCGGCACAACATGTATTG TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145439 |
Insert Size | 486 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145439.1 |
RefSeq Size | 1607 bp |
RefSeq ORF | 486 bp |
Locus ID | 27315 |
Protein Families | Druggable Genome, Transmembrane |
MW | 17.3 kDa |
Gene Summary | The protein encoded by this gene plays a role in the maturation of glycosylphosphatidylinositol (GPI) anchors on GPI-anchored proteins. Mutations in this gene are associated with an autosomal recessive syndrome characterized by hyperphosphatasia and intellectual disability. [provided by RefSeq, Jul 2017] Transcript Variant: This variant (3)omits an alternate in-frame coding exon, and represents use of an alternate promoter that results in inclusion of alternate exons, compared to variant 1. This extends the open reading frame resulting in a distinct N-terminus represented in isoform 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226646 | PGAP2 (Myc-DDK-tagged)-Human post-GPI attachment to proteins 2 (PGAP2), transcript variant 3 |
CNY 1,200.00 |
|
RC226646L3 | Lenti ORF clone of Human post-GPI attachment to proteins 2 (PGAP2), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC226646L4 | Lenti ORF clone of Human post-GPI attachment to proteins 2 (PGAP2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG226646 | PGAP2 (tGFP-tagged) - Human post-GPI attachment to proteins 2 (PGAP2), transcript variant 3 |
CNY 4,370.00 |