CHM (NM_001145414) Human Untagged Clone
CAT#: SC326527
CHM (untagged)-Human choroideremia (Rab escort protein 1) (CHM), transcript variant 2, mRNA
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DXS540; GGTA; HSD-32; REP-1; TCD |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC326527 representing NM_001145414.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGATACTCTCCCTTCGGAGTTTGATGTGATCGTAATAGGGACGGGTTTGCCTGAATCCATCATT GCAGCTGCATGTTCAAGAAGTGGCCGGAGAGTTCTGCATGTTGATTCAAGAAGCTACTATGGAGGAAAC TGGGCCAGTTTTAGCTTTTCAGGACTATTGTCCTGGCTAAAGGAATACCAGGAAAACAGTGACATTGTA AGTGACAGTCCAGTGTGGCAAGACCAGATCCTTGAAAATGAAGAAGCCATTGCTCTTAGCAGGAAGGAC AAAACTATTCAACATGTGGAAGTATTTTGTTATGCCAGGTCCACGCTGCTTTTATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145414 |
Insert Size | 333 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001145414.3 |
RefSeq Size | 2859 bp |
RefSeq ORF | 333 bp |
Locus ID | 1121 |
UniProt ID | P24386 |
Protein Families | Druggable Genome |
MW | 12.3 kDa |
Gene Summary | This gene encodes component A of the RAB geranylgeranyl transferase holoenzyme. In the dimeric holoenzyme, this subunit binds unprenylated Rab GTPases and then presents them to the catalytic Rab GGTase subunit for the geranylgeranyl transfer reaction. Rab GTPases need to be geranylgeranyled on either one or two cysteine residues in their C-terminus to localize to the correct intracellular membrane. Mutations in this gene are a cause of choroideremia; also known as tapetochoroidal dystrophy (TCD). This X-linked disease is characterized by progressive dystrophy of the choroid, retinal pigment epithelium and retina. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016] Transcript Variant: This variant (2) contains a novel 3' terminal exon and lacks many exons at the 3' end compared to variant 1. The resulting isoform (b) is shorter with a distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227117 | CHM (Myc-DDK-tagged)-Human choroideremia (Rab escort protein 1) (CHM), transcript variant 2 |
CNY 1,200.00 |
|
RC227117L3 | Lenti ORF clone of Human choroideremia (Rab escort protein 1) (CHM), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC227117L4 | Lenti ORF clone of Human choroideremia (Rab escort protein 1) (CHM), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG227117 | CHM (tGFP-tagged) - Human choroideremia (Rab escort protein 1) (CHM), transcript variant 2 |
CNY 4,370.00 |