United States
Germany
Japan
United Kingdom
China
PAFAH1B3 (NM_001145940) Human Untagged Clone
CAT＃: SC326454
PAFAH1B3 (untagged)-Human platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa (PAFAH1B3), transcript variant 3, mRNA
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PAFAHG |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC326454 representing NM_001145940.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGTGGAGAGGAGAACCCAGCCAGCAAGCCCACGCCGGTGCAGGACGTACAGGGCGACGGGCGCTGG ATGTCCCTGCACCATCGGTTCGTGGCTGACAGCAAAGATAAGGAACCCGAAGTCGTCTTCATCGGGGAC TCCTTGGTCCAGCTCATGCACCAGTGCGAGATCTGGCGCGAGCTCTTCTCTCCTCTGCATGCACTTAAC TTTGGCATTGGTGGTGACGGCACACAGCATGTACTGTGGCGGCTGGAGAATGGGGAGCTGGAACACATC CGGCCCAAGATTGTGGTGGTCTGGGTGGGCACCAACAACCACGGACACACAGCAGAGCAGGTGACTGGT GGCATCAAGGCCATTGTGCAACTGGTGAATGAGCGACAGCCCCAGGCCCGGGTTGTGGTGCTGGGCCTG CTTCCGCGAGGCCAACATCCCAACCCACTTCGGGAGAAGAACCGACAGGTGAACGAGCTGGTACGGGCG GCACTGGCTGGCCACCCTCGGGCCCACTTCCTAGATGCCGACCCTGGCTTTGTGCACTCAGATGGCACC ATCAGCCATCATGACATGTATGATTACCTGCATCTGAGCCGCCTGGGCTACACACCTGTTTGCCGGGCT CTGCACTCCCTGCTTCTGCGTCTGCTGGCCCAAGACCAGGGCCAAGGTGCTCCCCTGCTGGAGCCCGCA CCCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001145940 |
| Insert Size | 696 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001145940.1 |
| RefSeq Size | 869 bp |
| RefSeq ORF | 696 bp |
| Locus ID | 5050 |
| UniProt ID | Q15102 |
| Protein Families | Druggable Genome |
| Protein Pathways | Ether lipid metabolism, Metabolic pathways |
| MW | 25.7 kDa |
| Gene Summary | This gene encodes an acetylhydrolase that catalyzes the removal of an acetyl group from the glycerol backbone of platelet-activating factor. The encoded enzyme is a subunit of the platelet-activating factor acetylhydrolase isoform 1B complex, which consists of the catalytic beta and gamma subunits and the regulatory alpha subunit. This complex functions in brain development. A translocation between this gene on chromosome 19 and the CDC-like kinase 2 gene on chromosome 1 has been observed, and was associated with cognitive disability, ataxia, and atrophy of the brain. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227237 | PAFAH1B3 (Myc-DDK-tagged)-Human platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa) (PAFAH1B3), transcript variant 3 |
CNY 2,400.00 |
|
| RC227237L1 | Lenti ORF clone of Human platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa) (PAFAH1B3), transcript variant 3, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC227237L2 | Lenti ORF clone of Human platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa) (PAFAH1B3), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RC227237L3 | Lenti ORF clone of Human platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa) (PAFAH1B3), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC227237L4 | Lenti ORF clone of Human platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa) (PAFAH1B3), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG227237 | PAFAH1B3 (tGFP-tagged) - Human platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa) (PAFAH1B3), transcript variant 3 |
CNY 4,370.00 |
其它PAFAH1B3产品
