United States
Germany
Japan
United Kingdom
China
IRGM (NM_001145805) Human Untagged Clone
CAT＃: SC326449
IRGM (untagged)-Human immunity-related GTPase family, M (IRGM), mRNA
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | IFI1; IRGM1; LRG-47; LRG47 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001145805 edited
ATGGAAGCCATGAATGTTGAGAAAGCCTCAGCAGATGGGAACTTGCCAGAGGTGATCTCT AACATCAAGGAGACTCTGAAGATAGTGTCCAGGACACCAGTTAACATCACTATGGCAGGG GACTCTGGCAATGGGATGTCCACCTTCATCAGTGCCCTTCGAAACACAGGACATGAGGGT AAGGCCTCACCTCCTACTGAGCTGGTAAAAGCTACCCAAAGATGTGCCTCCTATTTCTCT TCCCACTTTTCAAATGTGGTGTTGTGGGACCTGCCTGGCACAGGGTCTGCCACCACAACC CTGGAGAACTACCTGATGGAAATGCAGTTCAACCGGTATGACTTCATCATGGTTGCATCT GCACAATTCAGCATGAATCATGTGATGCTTGCCAAAACCGCTGAGGACATGGGAAAGAAG TTCTACATTGTCTGGACCAAGCTAGACATGGACCTCAGCACAGGTGCCCTCCCAGAAGTG CAGCTACTGCAGATCAGAGAAAATGTCCTGGAAAATCTCCAGAAGGAGCGGGTATGTGAA TACTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001145805 |
| Insert Size | 500 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001145805.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001145805.1, NP_001139277.1 |
| RefSeq Size | 1659 bp |
| RefSeq ORF | 546 bp |
| Locus ID | 345611 |
| UniProt ID | A1A4Y4 |
| Gene Summary | This gene encodes a member of the p47 immunity-related GTPase family. The encoded protein may play a role in the innate immune response by regulating autophagy formation in response to intracellular pathogens. Polymorphisms that affect the normal expression of this gene are associated with a susceptibility to Crohn's disease and tuberculosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2016] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227287 | IRGM (Myc-DDK-tagged)-Human immunity-related GTPase family, M (IRGM) |
CNY 3,600.00 |
|
| RC227287L1 | Lenti-ORF clone of IRGM (Myc-DDK-tagged)-Human immunity-related GTPase family, M (IRGM) |
CNY 6,000.00 |
|
| RC227287L2 | Lenti-ORF clone of IRGM (mGFP-tagged)-Human immunity-related GTPase family, M (IRGM) |
CNY 6,000.00 |
|
| RC227287L3 | Lenti-ORF clone of IRGM (Myc-DDK-tagged)-Human immunity-related GTPase family, M (IRGM) |
CNY 5,890.00 |
|
| RC227287L4 | Lenti-ORF clone of IRGM (mGFP-tagged)-Human immunity-related GTPase family, M (IRGM) |
CNY 6,000.00 |
|
| RG227287 | IRGM (tGFP-tagged) - Human immunity-related GTPase family, M (IRGM) |
CNY 5,200.00 |
