United States
Germany
Japan
United Kingdom
China
CC2D2A (NM_020785) Human Untagged Clone
CAT＃: SC326386
CC2D2A (untagged)-Human coiled-coil and C2 domain containing 2A (CC2D2A), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | COACH2; JBTS9; MKS6 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC326386 representing NM_020785.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAATCCCAGGGAAGAAAAAGTAAAAATAATTACAGAGGAGTTCATTGAAAATGATGAGGATGCAGAC ATGGGAAGACAGAATAAGAACTCAAAGGTTCGAAGACAGCCAAGAAAGAAACAGAAGCCAACTCCTTTC TCCCGAGCCTGCTGGCAGATCCTCCCCCACCTCTCCGCAGGAGTTCCCCTCCTAGGCTGGGAGCATCCC GTGCAGGGTAAATCTTTTCAAGCCACCAACTGCTGTCCCCAAGGAAATGGTGTCCGAAAAATCCCACCT TGGCAACCCCCAGGAGCCTGTGCAGGAGGAGCCCAAGACCCGCCTCCTGAGTATGACAGTCCGGAGAGG CCCACGGAGAGAGCTGGTTGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_020785 |
| Insert Size | 369 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_020785.2 |
| RefSeq Size | 1682 bp |
| RefSeq ORF | 369 bp |
| Locus ID | 57545 |
| UniProt ID | Q9P2K1 |
| MW | 13.6 kDa |
| Gene Summary | This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) lacks an alternate exon in the 5' coding region that results in a frameshift, and differs in the presence and absence of exons at its 3' end, compared to variant 1. The encoded isoform (b) has a distinct and significantly shorter C-terminus, compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226404 | CC2D2A (Myc-DDK-tagged)-Human coiled-coil and C2 domain containing 2A (CC2D2A), transcript variant 2 |
CNY 1,800.00 |
|
| RC226404L1 | Lenti-ORF clone of CC2D2A (Myc-DDK-tagged)-Human coiled-coil and C2 domain containing 2A (CC2D2A), transcript variant 2 |
CNY 4,200.00 |
|
| RC226404L2 | Lenti-ORF clone of CC2D2A (mGFP-tagged)-Human coiled-coil and C2 domain containing 2A (CC2D2A), transcript variant 2 |
CNY 6,840.00 |
|
| RC226404L3 | Lenti-ORF clone of CC2D2A (Myc-DDK-tagged)-Human coiled-coil and C2 domain containing 2A (CC2D2A), transcript variant 2 |
CNY 6,840.00 |
|
| RC226404L4 | Lenti-ORF clone of CC2D2A (mGFP-tagged)-Human coiled-coil and C2 domain containing 2A (CC2D2A), transcript variant 2 |
CNY 6,840.00 |
|
| RG226404 | CC2D2A (tGFP-tagged) - Human coiled-coil and C2 domain containing 2A (CC2D2A), transcript variant 2 |
CNY 5,420.00 |
