United States
Germany
Japan
United Kingdom
China
BAIAP2 (NM_001144888) Human Untagged Clone
CAT＃: SC326039
BAIAP2 (untagged)-Human BAI1-associated protein 2 (BAIAP2), transcript variant 4
CNY 8,550.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BAP2; FLAF3; IRSP53; WAML |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001144888, the custom clone sequence may differ by one or more nucleotides
ATGTCTCTGTCTCGCTCAGAGGAGATGCACCGGCTCACGGAAAATGTCTATAAGACCATC ATGGAGCAGTTCAACCCTAGCCTCCGGAACTTCATCGCCATGGGGAAGAATTACGAGAAG GCACTGGCAGGTGTGACGTATGCAGCCAAAGGCTACTTTGACGCCCTGGTGAAGATGGGG GAGCTGGCCAGCGAGAGCCAGGGCTCCAAAGAACTCGGAGACGTTCTCTTCCAGATGGCT GAAGTCCACAGGCAGATCCAGAATCAGCTGGAAGAAATGCTGAAGTCTTTTCACAACGAG CTGCTTACGCAGCTGGAGCAGAAGGTGGAGCTGGACTCCAGGTATCTGAGTGCTGCGCTG AAGAAATACCAGACTGAGCAAAGGAGCAAAGGCGACGCCCTGGACAAGTGTCAGGCTGAG CTGAAGAAGCTTCGGAAGAAGAGCCAGGGCAGCAAGAATCCTCAGAAGTACTCGGACAAG GAGCTGCAGTACATCGACGCCATCAGCAACAAGCAGGGCGAGCTGGAGAATTACGTGTCC GACGGCTACAAGACCGCACTGACAGAGGAGCGCAGGCGCTTCTGCTTCCTGGTGGAGAAG CAGTGCGCCGTGGCCAAGAACTCCGCGGCCTACCACTCCAAGGGCAAGGAGCTGCTGGCG CAGAAGCTGCCGCTGTGGCAACAGGCCTGTGCCGACCCCAGCAAGATCCCGGAGCGCGCG GTGCAGCTCATGCAGCAGGTGGCCAGCAACGGCGCCACCCTCCCCAGCGCCCTGTCGGCC TCCAAGTCCAACCTGGTCATTTCCGACCCCATTCCGGGGGCCAAGCCCCTGCCGGTGCCC CCCGAGCTGGCACCGTTCGTGGGGCGGATGTCTGCCCAGGAGAGCACACCCATCATGAAC GGCGTCACAGGCCCGGATGGCGAGGACTACAGCCCGTGGGCTGACCGCAAGGCTGCCCAG CCCAAATCCCTGTCTCCTCCGCAGTCTCAGAGCAAGCTCAGCGACTCCTACTCCAACACA CTCCCCGTGCGCAAGAGCGTGACCCCAAAAAACAGCTATGCCACCACCGAGAACAAGACT CTGCCTCGCTCGAGCTCCATGGCAGCCGGCCTGGAGCGCAATGGCCGTATGCGGGTGAAG GCCATCTTCTCCCACGCTGCTGGGGACAACAGCACCCTCCTGAGCTTCAAGGAGGGTGAC CTCATTACCCTGCTGGTGCCTGAGGCCCGCGATGGCTGGCACTACGGAGAGAGTGAGAAG ACCAAGATGCGGGGCTGGTTTCCCTTCTCCTACACCCGGGTCTTGGACAGCGATGGCAGT GACAGGCTGCACATGAGCCTGCAGCAAGGGAAGAGCAGCAGCACGGGCAACCTCCTGGAC AAGGACGACCTGGCCATCCCACCCCCCGATTACGGCGCCGCCTCCCGGGCCTTCCCCGCC CAGACGGCCAGCGGCTTCAAGCAGAGGCCCTACAGTGTGGCCGTGCCCGCCTTCTCCCAG GGCCTGGATGACTATGGAGCGCGGTCCATGAGCAGGAATCCCTTTGCCCACGTCCAGCTG AAGCCGACAGTGACCAACGACAGGTCTGCCCCCCTCCTCAGC |
| Restriction Sites | Please inquire |
| ACCN | NM_001144888 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001144888.1, NP_001138360.1 |
| RefSeq Size | 3306 bp |
| RefSeq ORF | 1605 bp |
| Locus ID | 10458 |
| UniProt ID | Q9UQB8 |
| Protein Families | Druggable Genome |
| Protein Pathways | Adherens junction, Regulation of actin cytoskeleton |
| Gene Summary | The protein encoded by this gene has been identified as a brain-specific angiogenesis inhibitor (BAI1)-binding protein. This adaptor protein links membrane bound G-proteins to cytoplasmic effector proteins. This protein functions as an insulin receptor tyrosine kinase substrate and suggests a role for insulin in the central nervous system. It also associates with a downstream effector of Rho small G proteins, which is associated with the formation of stress fibers and cytokinesis. This protein is involved in lamellipodia and filopodia formation in motile cells and may affect neuronal growth-cone guidance. This protein has also been identified as interacting with the dentatorubral-pallidoluysian atrophy gene, which is associated with an autosomal dominant neurodegenerative disease. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009] Transcript Variant: This variant (4) shares identical sequence with variants 1, 2 and 3, but diverges after amino acid 511 resulting in a distinct 23 amino acid sequence at the C-terminus. This transcript variant is alternatively referred to as variant M. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because transcript sequence consistent with the reference genome assembly was not available for all regions of the RefSeq transcript. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227023 | BAIAP2 (Myc-DDK-tagged)-Human BAI1-associated protein 2 (BAIAP2), transcript variant 4 |
CNY 5,960.00 |
|
| RC227023L3 | Lenti-ORF clone of BAIAP2 (Myc-DDK-tagged)-Human BAI1-associated protein 2 (BAIAP2), transcript variant 4 |
CNY 6,460.00 |
|
| RC227023L4 | Lenti-ORF clone of BAIAP2 (mGFP-tagged)-Human BAI1-associated protein 2 (BAIAP2), transcript variant 4 |
CNY 6,460.00 |
|
| RG227023 | BAIAP2 (tGFP-tagged) - Human BAI1-associated protein 2 (BAIAP2), transcript variant 4 |
CNY 7,560.00 |
