United States
Germany
Japan
United Kingdom
China
ERG (NM_001136154) Human Untagged Clone
CAT＃: SC325982
ERG (untagged)-Human v-ets erythroblastosis virus E26 oncogene homolog (avian) (ERG), transcript variant 3
CNY 5,488.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | erg-3; p55 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001136154 edited
ATGATTCAGACTGTCCCGGACCCAGCAGCTCATATCAAGGAAGCCTTATCAGTTGTGAGT GAGGACCAGTCGTTGTTTGAGTGTGCCTACGGAACGCCACACCTGGCTAAGACAGAGATG ACCGCGTCCTCCTCCAGCGACTATGGACAGACTTCCAAGATGAGCCCACGCGTCCCTCAG CAGGATTGGCTGTCTCAACCCCCAGCCAGGGTCACCATCAAAATGGAATGTAACCCTAGC CAGGTGAATGGCTCAAGGAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATG GTGGGCAGCCCAGACACCGTTGGGATGAACTACGGCAGCTACATGGAGGAGAAGCACATG CCACCCCCAAACATGACCACGAACGAGCGCAGAGTTATCGTGCCAGCAGATCCTACGCTA TGGAGTACAGACCATGTGCGGCAGTGGCTGGAGTGGGCGGTGAAAGAATATGGCCTTCCA GACGTCAACATCTTGTTATTCCAGAACATCGATGGGAAGGAACTGTGCAAGATGACCAAG GACGACTTCCAGAGGCTCACCCCCAGCTACAATGCCGACATCCTTCTCTCACATCTCCAC TACCTCAGAGAGACTCCTCTTCCACATTTGACTTCAGATGATGTTGATAAAGCCTTACAA AACTCTCCACGGTTAATGCATGCTAGAAACACAGGGGGTGCAGCTTTTATTTTCCCAAAT ACTTCAGTATATCCTGAAGCTACGCAAAGAATTACAACTAGGCCAGATTTACCATATGAG CCCCCCAGGAGATCAGCCTGGACCGGTCACGGCCACCCCACGCCCCAGTCGAAAGCTGCT CAACCATCTCCTTCCACAGTGCCCAAAACTGAAGACCAGCGTCCTCAGTTAGATCCTTAT CAGATTCTTGGACCAACAAGTAGCCGCCTTGCAAATCCAGGCAGTGGCCAGATCCAGCTT TGGCAGTTCCTCCTGGAGCTCCTGTCGGACAGCTCCAACTCCAGCTGCATCACCTGGGAA GGCACCAACGGGGAGTTCAAGATGACGGATCCCGACGAGGTGGCCCGGCGCTGGGGAGAG CGGAAGAGCAAACCCAACATGAACTACGATAAGCTCAGCCGCGCCCTCCGTTACTACTAT GACAAGAACATCATGACCAAGGTCCATGGGAAGCGCTACGCCTACAAGTTCGACTTCCAC GGGATCGCCCAGGCCCTCCAGCCCCACCCCCCGGAGTCATCTCTGTACAAGTACCCCTCA GACCTCCCGTACATGGGCTCCTATCACGCCCACCCACAGAAGATGAACTTTGTGGCGCCC CACCCTCCAGCCCTCCCCGTGACATCTTCCAGTTTTTTTGCTGCCCCAAACCCATACTGG AATTCACCAACTGGGGGTATATACCCCAACACTAGGCTCCCCACCAGCCATATGCCTTCT CATCTGGGCACTTACTACTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001136154 |
| Insert Size | 1500 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001136154.1, NP_001129626.1 |
| RefSeq Size | 5114 bp |
| RefSeq ORF | 1461 bp |
| Locus ID | 2078 |
| UniProt ID | P11308 |
| Protein Families | Druggable Genome, Transcription Factors |
| Gene Summary | This gene encodes a member of the erythroblast transformation-specific (ETS) family of transcriptions factors. All members of this family are key regulators of embryonic development, cell proliferation, differentiation, angiogenesis, inflammation, and apoptosis. The protein encoded by this gene is mainly expressed in the nucleus. It contains an ETS DNA-binding domain and a PNT (pointed) domain which is implicated in the self-association of chimeric oncoproteins. This protein is required for platelet adhesion to the subendothelium, inducing vascular cell remodeling. It also regulates hematopoesis, and the differentiation and maturation of megakaryocytic cells. This gene is involved in chromosomal translocations, resulting in different fusion gene products, such as TMPSSR2-ERG and NDRG1-ERG in prostate cancer, EWS-ERG in Ewing's sarcoma and FUS-ERG in acute myeloid leukemia. More than two dozens of transcript variants generated from combinatorial usage of three alternative promoters and multiple alternative splicing events have been reported, but the full-length nature of many of these variants has not been determined. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (3) and variant 5 encode the longest protein (isoform 3). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227285 | ERG (Myc-DDK-tagged)-Human v-ets erythroblastosis virus E26 oncogene homolog (avian) (ERG), transcript variant 3 |
CNY 5,488.00 |
|
| RC227285L1 | Lenti-ORF clone of ERG (Myc-DDK-tagged)-Human v-ets erythroblastosis virus E26 oncogene homolog (avian) (ERG), transcript variant 3 |
CNY 7,888.00 |
|
| RC227285L2 | Lenti-ORF clone of ERG (mGFP-tagged)-Human v-ets erythroblastosis virus E26 oncogene homolog (avian) (ERG), transcript variant 3 |
CNY 5,890.00 |
|
| RC227285L3 | Lenti-ORF clone of ERG (Myc-DDK-tagged)-Human v-ets erythroblastosis virus E26 oncogene homolog (avian) (ERG), transcript variant 3 |
CNY 5,890.00 |
|
| RC227285L4 | Lenti-ORF clone of ERG (mGFP-tagged)-Human v-ets erythroblastosis virus E26 oncogene homolog (avian) (ERG), transcript variant 3 |
CNY 7,888.00 |
|
| RG227285 | ERG (tGFP-tagged) - Human v-ets erythroblastosis virus E26 oncogene homolog (avian) (ERG), transcript variant 3 |
CNY 7,088.00 |
