United States
Germany
Japan
United Kingdom
China
ELAVL4 (NM_001144775) Human Untagged Clone
CAT＃: SC325857
ELAVL4 (untagged)-Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), transcript variant 3
CNY 5,488.00
Product images
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HUD; PNEM |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>SC325857 representing NM_001144775
Red=Cloning site Blue=ORF CTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGAGATTACTTCTTTTAAGGGAAATTGTCA TTAATGAGTCAAGAAACTGCTCATTTATGATAATTAGCACCATGGAGCCTCAGGTGTCAAATGGTCCGAC ATCCAATACAAGCAATGGACCCTCCAGCAACAACAGAAACTGTCCTTCTCCCATGCAAACAGGGGCAACC ACAGATGACAGCAAAACCAACCTCATCGTCAACTATTTACCCCAGAATATGACCCAAGAAGAATTCAGGA GTCTCTTCGGGAGCATTGGTGAAATAGAATCCTGCAAACTTGTGAGAGACAAAATTACAGGACAGAGTTT AGGGTATGGATTTGTTAACTATATTGATCCAAAGGATGCAGAGAAAGCCATCAACACTTTAAATGGACTC AGACTCCAGACCAAAACCATAAAGGTCTCATATGCCCGTCCGAGCTCTGCCTCAATCAGGGATGCTAACC TCTATGTTAGCGGCCTTCCCAAAACCATGACCCAGAAGGAACTGGAGCAACTTTTCTCGCAATACGGCCG TATCATCACCTCACGAATCCTGGTTGATCAAGTCACAGGAGTGTCCAGAGGGGTGGGATTCATCCGCTTT GATAAGAGGATTGAGGCAGAAGAAGCCATCAAAGGGCTGAATGGCCAGAAGCCCAGCGGTGCTACGGAAC CGATTACTGTGAAGTTTGCCAACAACCCCAGCCAGAAGTCCAGCCAGGCCCTGCTCTCCCAGCTCTACCA GTCCCCCAACCGGCGCTACCCAGGTCCACTTCACCACCAGGCTCAGAGGTTCAGGCTGGACAATTTGCTT AATATGGCCTATGGCGTAAAGAGGTTCTCCCCAATTACCATTGATGGAATGACAAGCCTTGTGGGAATGA ACATCCCTGGTCACACAGGAACTGGGTGGTGCATCTTTGTCTACAACCTGTCCCCCGATTCCGATGAGAG TGTCCTCTGGCAGCTCTTTGGCCCCTTTGGAGCAGTGAACAACGTAAAGGTGATTCGTGACTTCAACACC AACAAGTGCAAGGGATTCGGCTTTGTCACCATGACCAACTATGATGAGGCGGCCATGGCCATCGCCAGCC TCAACGGGTACCGCCTGGGAGACAGAGTGTTGCAAGTTTCCTTTAAAACCAACAAAGCCCACAAGTCCTG AACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCA |
| Restriction Sites | Please inquire |
| ACCN | NM_001144775 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001144775.1, NP_001138247.1 |
| RefSeq Size | 1884 bp |
| RefSeq ORF | 1152 bp |
| Locus ID | 1996 |
| UniProt ID | P26378 |
| Protein Families | Druggable Genome |
| Gene Summary | May play a role in neuron-specific RNA processing. Protects CDKN1A mRNA from decay by binding to its 3' UTR (By similarity). Binds to AU-rich sequences (AREs) of target mRNAs, including VEGF and FOS mRNA.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is longer than isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226929 | ELAVL4 (Myc-DDK-tagged)-Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), transcript variant 3 |
CNY 5,488.00 |
|
| RC226929L3 | Lenti ORF clone of Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC226929L4 | Lenti ORF clone of Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG226929 | ELAVL4 (tGFP-tagged) - Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), transcript variant 3 |
CNY 4,370.00 |
