SMAD3 (NM_001145103) Human Untagged Clone

CAT#: SC325853

SMAD3 (untagged)-Human SMAD family member 3 (SMAD3), transcript variant 3



  "NM_001145103" in other vectors (4)

CNY 6,180.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Smad2/3 (Thr8) Antibody (Phospho-specific)
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HSPC193; HsT17436; JV15-2; LDS1C; LDS3; MADH3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325853 representing NM_001145103.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTTGCCTGCACCCTAGGCAAACGTGGAAAGGCGCAGCTCTGGTACACCGGAAAGCATGGTGGATG
GGGAGGTCCCTGGATGGCCGGTTGCAGGTGTCCCATCGGAAGGGGCTCCCTCATGTCATCTACTGCCGC
CTGTGGCGATGGCCAGACCTGCACAGCCACCACGAGCTACGGGCCATGGAGCTGTGTGAGTTCGCCTTC
AATATGAAGAAGGACGAGGTCTGCGTGAATCCCTACCACTACCAGAGAGTAGAGACACCAGTTCTACCT
CCTGTGTTGGTGCCACGCCACACAGAGATCCCGGCCGAGTTCCCCCCACTGGACGACTACAGCCATTCC
ATCCCCGAAAACACTAACTTCCCCGCAGGCATCGAGCCCCAGAGCAATATTCCAGAGACCCCACCCCCT
GGCTACCTGAGTGAAGATGGAGAAACCAGTGACCACCAGATGAACCACAGCATGGACGCAGGTTCTCCA
AACCTATCCCCGAATCCGATGTCCCCAGCACATAATAACTTGGACCTGCAGCCAGTTACCTACTGCGAG
CCGGCCTTCTGGTGCTCCATCTCCTACTACGAGCTGAACCAGCGCGTCGGGGAGACATTCCACGCCTCG
CAGCCATCCATGACTGTGGATGGCTTCACCGACCCCTCCAATTCGGAGCGCTTCTGCCTAGGGCTGCTC
TCCAATGTCAACAGGAATGCAGCAGTGGAGCTGACACGGAGACACATCGGAAGAGGCGTGCGGCTCTAC
TACATCGGAGGGGAGGTCTTCGCAGAGTGCCTCAGTGACAGCGCTATTTTTGTCCAGTCTCCCAACTGT
AACCAGCGCTATGGCTGGCACCCGGCCACCGTCTGCAAGATCCCACCAGGATGCAACCTGAAGATCTTC
AACAACCAGGAGTTCGCTGCCCTCCTGGCCCAGTCGGTCAACCAGGGCTTTGAGGCTGTCTACCAGTTG
ACCCGAATGTGCACCATCCGCATGAGCTTCGTCAAAGGCTGGGGAGCGGAGTACAGGAGACAGACTGTG
ACCAGTACCCCCTGCTGGATTGAGCTGCACCTGAATGGGCCTTTGCAGTGGCTTGACAAGGTCCTCACC
CAGATGGGCTCCCCAAGCATCCGCTGTTCCAGTGTGTCTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145103
Insert Size 1146 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001145103.1
RefSeq Size 5808 bp
RefSeq ORF 1146 bp
Locus ID 4088
UniProt ID P84022
Protein Families Cancer stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Stem cell relevant signaling - JAK/STAT signaling pathway, Stem cell relevant signaling - TGFb/BMP signaling pathway, Transcription Factors
Protein Pathways Adherens junction, Cell cycle, Chronic myeloid leukemia, Colorectal cancer, Pancreatic cancer, Pathways in cancer, TGF-beta signaling pathway, Wnt signaling pathway
MW 43.2 kDa
Gene Summary The SMAD family of proteins are a group of intracellular signal transducer proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. The SMAD3 protein functions in the transforming growth factor-beta signaling pathway, and transmits signals from the cell surface to the nucleus, regulating gene activity and cell proliferation. It also functions as a tumor suppressor. Mutations in this gene are associated with aneurysms-osteoarthritis syndrome and Loeys-Dietz Syndrome 3. [provided by RefSeq, Nov 2019]
Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...