Caspase 5 (CASP5) (NM_001136109) Human Untagged Clone

CAT#: SC325844

CASP5 (untagged)-Human caspase 5, apoptosis-related cysteine peptidase (CASP5), transcript variant b



  "NM_001136109" in other vectors (4)

CNY 6,180.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CASP5 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ICE(rel)III; ICEREL-III; ICH-3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325844 representing NM_001136109.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGAAGACAACCACAAAAAAAAAACAGTTAAGATGTTGGAATACCTGGGCAAAGATGTTCTTCAT
GGTGTTTTTAATTATTTGGCAAAACACGATGTTCTGACATTGAAGGAAGAGGAAAAGAAAAAATATTAT
GATACCAAAATTGAAGACAAGGCCCTGATCTTGGTAGACTCTTTGCGAAAGAATCGCGTGGCTCATCAA
ATGTTTACCCAAACACTTCTCAATATGGACCAAAAGATCACCAGTGTAAAACCTCTTCTGCAAATCGAG
GCTGGACCACCTGAGTCAGCAGAATCTACAAATATACTCAAACTTTGTCCTCGTGAAGAATTCCTGAGA
CTGTGTAAAAAAAATCATGATGAGATCTATCCAATAAAAAAGAGAGAGGACCGCAGACGCCTGGCTCTC
ATCATATGCAATACAAAGTTTGATCACCTGCCTGCAAGGAATGGGGCTCACTATGACATCGTGGGGATG
AAAAGGCTGCTTCAAGGCCTGGGCTACACTGTGGTTGACGAAAAGAATCTCACAGCCAGGGATATGGAG
TCAGTGCTGAGGGCATTTGCTGCCAGACCAGAGCACAAGTCCTCTGACAGCACGTTCTTGGTACTCATG
TCTCATGGCATCCTAGAGGGAATCTGCGGAACTGCGCATAAAAAGAAAAAACCGGATGTGCTGCTTTAT
GACACCATCTTCCAGATATTCAACAACCGCAACTGCCTCAGTCTAAAGGACAAACCCAAGGTCATCATT
GTCCAGGCCTGCAGAGGTGAAAAACATGGGGAACTCTGGGTCAGAGACTCTCCAGCATCCTTGGCACTC
ATCTCTTCACAGTCATCTGAGAACCTGGAGGCAGATTCTGTTTGCAAGATCCACGAGGAGAAGGACTTC
ATTGCTTTCTGTTCTTCAACACCACATAACGTGTCCTGGAGAGACCGCACAAGGGGCTCCATCTTCATT
ACGGAACTCATCACATGCTTCCAGAAATATTCTTGCTGCTGCCACCTAATGGAAATATTTCGGAAGGTA
CAGAAATCATTTGAAGTTCCACAGGCTAAAGCCCAGATGCCCACCATAGAACGAGCAACCTTGACAAGA
GATTTCTACCTCTTTCCTGGCAATTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001136109
Insert Size 1131 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001136109.1
RefSeq Size 1275 bp
RefSeq ORF 1131 bp
Locus ID 838
UniProt ID P51878
Protein Families Druggable Genome, Protease
Protein Pathways NOD-like receptor signaling pathway
MW 43.3 kDa
Gene Summary This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. Overexpression of the active form of this enzyme induces apoptosis in fibroblasts. Max, a central component of the Myc/Max/Mad transcription regulation network important for cell growth, differentiation, and apoptosis, is cleaved by this protein; this process requires Fas-mediated dephosphorylation of Max. The expression of this gene is regulated by interferon-gamma and lipopolysaccharide. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010]
Transcript Variant: This variant (b) is lacking an in-frame coding exon compared to transcript variant a, resulting in a shorter isoform (b) missing a 58 aa protein segment compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...