USP46 (NM_001134223) Human Untagged Clone
CAT#: SC325818
USP46 (untagged)-Human ubiquitin specific peptidase 46 (USP46), transcript variant 2
CNY 5,800.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001134223, the custom clone sequence may differ by one or more nucleotides
ATGAATTGTTTTCAGGGCACCAATGCCTCTGCTCTGGAAAAAGACATTGGTCCAGAGCAG TTTCCAATCAATGAACACTATTTCGGATTGGTCAATTTTGGAAACACATGCTACTGTAAC TCCGTGCTTCAGGCATTGTACTTCTGCCGTCCATTCCGGGAGAATGTGTTGGCATACAAG GCCCAGCAAAAGAAGAAGGAAAACTTGCTGACGTGCCTGGCGGACCTTTTCCACAGCATT GCCACACAGAAGAAGAAGGTTGGCGTCATCCCACCAAAGAAGTTCATTTCAAGGCTGAGA AAAGAGAATGATCTCTTTGATAACTACATGCAGCAGGATGCTCATGAATTTTTAAATTAT TTGCTAAACACTATTGCGGACATCCTTCAGGAGGAGAAGAAACAGGAAAAACAAAATGGA AAATTAAAAAATGGCAACATGAACGAACCTGCGGAAAATAATAAACCAGAACTCACCTGG GTCCATGAGATTTTTCAGGGAACGCTTACCAATGAAACTCGATGCTTGAACTGTGAAACT GTTAGTAGCAAAGATGAAGATTTTCTTGACCTTTCTGTTGATGTGGAGCAGAATACATCC ATTACCCACTGTCTAAGAGACTTCAGCAACACAGAAACACTGTGTAGTGAACAAAAATAT TATTGTGAAACATGCTGCAGCAAACAAGAAGCCCAGAAAAGGATGAGGGTAAAAAAGCTG CCCATGATCTTGGCCCTGCACCTAAAGCGGTTCAAGTACATGGAGCAGCTGCACAGATAC ACCAAGCTGTCTTACCGTGTGGTCTTCCCTCTGGAACTCCGGCTCTTCAACACCTCCAGT GATGCAGTGAACCTGGACCGCATGTATGACTTGGTTGCGGTGGTCGTTCACTGTGGCAGT GGTCCTAATCGTGGGCATTATATCACTATTGTGAAAAGTCACGGCTTCTGGCTTTTGTTT GATGATGACATTGTAGAGAAAATAGATGCTCAAGCTATTGAAGAATTCTATGGCCTGACG TCAGATATATCAAAAAATTCAGAATCTGGATATATTTTATTCTATCAGTCAAGAGAG |
Restriction Sites | Please inquire |
ACCN | NM_001134223 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001134223.1, NP_001127695.1 |
RefSeq Size | 8057 bp |
RefSeq ORF | 1080 bp |
Locus ID | 64854 |
UniProt ID | P62068 |
Protein Families | Druggable Genome, Protease |
Gene Summary | Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP46 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Jun 2009] Transcript Variant: This variant (2) contains an alternate 5'-terminal exon and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a shorter and distinct N-terminus, compared isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225534 | USP46 (Myc-DDK-tagged)-Human ubiquitin specific peptidase 46 (USP46), transcript variant 2 |
CNY 3,656.00 |
|
RC225534L3 | Lenti-ORF clone of USP46 (Myc-DDK-tagged)-Human ubiquitin specific peptidase 46 (USP46), transcript variant 2 |
CNY 5,890.00 |
|
RC225534L4 | Lenti-ORF clone of USP46 (mGFP-tagged)-Human ubiquitin specific peptidase 46 (USP46), transcript variant 2 |
CNY 5,890.00 |
|
RG225534 | USP46 (tGFP-tagged) - Human ubiquitin specific peptidase 46 (USP46), transcript variant 2 |
CNY 4,370.00 |