DSN1 (NM_001145316) Human Untagged Clone
CAT#: SC325814
DSN1 (untagged)-Human DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) (DSN1), transcript variant 1
CNY 5,488.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C20orf172; dJ469A13.2; hKNL-3; KNL3; MIS13 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001145316, the custom clone sequence may differ by one or more nucleotides
ATGACTTCAGTGACTAGATCAGAGATCATAGATGAAAAAGGACCAGTGATGTCTAAGACTCATGATCATC AATTGGAATCAAGTCTCAGTCCTGTGGAAGTGTTTGCTAAAACATCTGCCTCCCTGGAGATGAATCAAGG CGTTTCAGAGGAAAGAATTCACCTTGGCTCTAGCCCTAAAAAAGGGGGAAATTGTGATCTCAGCCACCAG GAAAGACTTCAGTCGAAGTCCCTTCATTTGTCTCCTCAAGAACAATCTGCCAGTTATCAAGACAGGAGGC AATCCTGGCGGCGAGCAAGTATGAAAGAAACGAACCGGCGGAAGTCGCTGCATCCCATTCACCAGGGCAT CACAGAGCTCAGCCGGTCTATCAGTGTCGATTTAGCAGAAAGCAAACGGCTTGGCTGTCTCCTGCTTTCC AGTTTCCAGTTCTCTATTCAGAAACTTGAACCTTTCCTAAGGGACACTAAGGGCTTCAGTCTTGAAAGTT TTAGAGCCAAAGCATCTTCTCTTTCTGAAGAATTGAAACATTTTGCAGACGGACTGGAAACTGATGGAAC TCTACAAAAATGTTTTGAAGATTCAAATGGAAAAGCATCAGATTTTTCTTTGGAAGCATCTGTGGCTGAG ATGAAGGAATACATAACAAAGTTTTCTTTAGAACGTCAGACTTGGGATCAGCTCTTGCTTCACTACCAGC AGGAGGCTAAAGAGATATTGTCCAGAGGATCAACTGAGGCCAAAATTACTGAGGTCAAAGTGGAACCTAT GACATATCTTGGGTCTTCTCAGAATGAAGTTCTTAATACAAAACCTGACTACCAGAAAATATTACAGAAC CAGAGCAAAGTCTTTGACTGTATGGAGTTGGTGATGGATGAACTGCAAGGATCAGTGAAACAGCTGCAGG CCTTTATGGATGAAAGTACCCAGTGCTTCCAGAAGGTGTCAGTACAGCTCGGAAAGAGAAGCATGCAACA ATTAGATCCCTCACCAGCTCGAAAACTGTTGAAGCTTCAGCTACAGAACCCACCTGCCATACATGGATCT GGATCTGGATCTTGTCAGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001145316 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145316.1, NP_001138788.1 |
RefSeq Size | 2441 bp |
RefSeq ORF | 1071 bp |
Locus ID | 79980 |
UniProt ID | Q9H410 |
Gene Summary | This gene encodes a kinetochore protein that functions as part of the minichromosome instability-12 centromere complex. The encoded protein is required for proper kinetochore assembly and progression through the cell cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2009] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226614 | DSN1 (Myc-DDK-tagged)-Human DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) (DSN1), transcript variant 1 |
CNY 5,488.00 |
|
RC226614L1 | Lenti ORF clone of Human DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) (DSN1), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC226614L2 | Lenti ORF clone of Human DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) (DSN1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC226614L3 | Lenti ORF clone of Human DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) (DSN1), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC226614L4 | Lenti ORF clone of Human DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) (DSN1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG226614 | DSN1 (tGFP-tagged) - Human DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) (DSN1), transcript variant 1 |
CNY 4,370.00 |