RAD51D (NM_001142571) Human Untagged Clone

CAT#: SC325802

RAD51D (untagged)-Human RAD51-like 3 (S. cerevisiae) (RAD51L3), transcript variant 6



  "NM_001142571" in other vectors (4)

CNY 5,610.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Mouse Monoclonal Rad51D Antibody (5B3/6)
    • 100 ul

CNY 5,381.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BROVCA4; R51H3; RAD51L3; TRAD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325802 representing NM_001142571.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCGTGCTCAGGGTCGGACTGTGCCCTGGCCTTACCGAGGAGATGATCCAGCTTCTCAGGAGCCAC
AGGATCAAGACAGTGGTGGACCTGGTTTCTGCAGACCTGGAAGAGGTAGCTCAGAAATGTGGCTTGTCT
TACAAGACATGGAGGGCGCACTCAAGTGGGAACCTGGGAGGACTGCAGCTGCCTCAGGTCCCCGCAGGG
AGATCGTGGAGTGGGGTCAGGAATGCTCTGAAGAAGGCAGGACTTGGGCATGGAGGAACAGATGGACTT
TCGCTGAATGCTTTCGATGAACGAGGCACTGCGGTCAGCACTTCACGTCTTGATAAACTGCTTGATGCT
GGTCTCTATACTGGAGAAGTGACTGAAATTGTAGGAGGCCCAGGTAGCGGCAAAACTCAGGTATGTCTC
TGTATGGCAGCAAATGTGGCCCATGGCCTGCAGCAAAACGTCCTATATGTAGATTCCAATGGAGGGCTG
ACAGCTTCCCGCCTCCTCCAGCTGCTTCAGGCTAAAACCCAGGATGAGGAGGAACAGGCAGAAGCTCTC
CGGAGGATCCAGGTGGTGCATGCATTTGACATCTTCCAGATGCTGGATGTGCTGCAGGAGCTCCGAGGC
ACTGTGGCCCAGCAGGTGACTGGTTCTTCAGGAACTGTGAAGGTGGTGGTTGTGGACTCGGTCACTGCG
GTGGTTTCCCCACTTCTGGGAGGTCAGCAGAGGGAAGGCTTGGCCTTGATGATGCAGCTGGCCCGAGAG
CTGAAGACCCTGGCCCGGGACCTTGGCATGGCAGTGGTGGTGACCAACCACATAACTCGAGACAGGGAC
AGCGGGAGGCTCAAACCTGCCCTCGGACGCTCCTGGAGCTTTGTGCCCAGCACTCGGATTCTCCTGGAC
ACCATCGAGGGAGCAGGAGCATCAGGCGGCCGGCGCATGGCGTGTCTGGCCAAATCTTCCCGACAGCCA
ACAGGTTTCCAGGAGATGGTAGACATTGGGACCTGGGGGACCTCAGAGCAGAGTGCCACATTACAGGGT
GATCAGACATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001142571
Insert Size 1047 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001142571.1
RefSeq Size 2478 bp
RefSeq ORF 1047 bp
Locus ID 5892
UniProt ID O75771
Protein Families Druggable Genome
Protein Pathways Homologous recombination
MW 37 kDa
Gene Summary The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51, which are known to be involved in the homologous recombination and repair of DNA. This protein forms a complex with several other members of the RAD51 family, including RAD51L1, RAD51L2, and XRCC2. The protein complex formed with this protein has been shown to catalyze homologous pairing between single- and double-stranded DNA, and is thought to play a role in the early stage of recombinational repair of DNA. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream ring finger and FYVE-like domain containing 1 (RFFL) gene. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (6) lacks an in-frame exon but instead includes a different in-frame exon in the 5' coding region, compared to variant 1. The encoded isoform (6) is longer than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...