IKK gamma (IKBKG) (NM_001145255) Human Untagged Clone

CAT#: SC325768

IKBKG (untagged)-Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), transcript variant 4



  "NM_001145255" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
IKBKG mouse monoclonal antibody,clone OTI3C3
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AMCBX1; EDAID1; FIP-3; FIP3; Fip3p; IKK-gamma; IKKAP1; IKKG; IMD33; IP; IP1; IP2; IPD2; NEMO; ZC2HC9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325768 representing NM_001145255.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAATAGGCACCTCTGGAAGAGCCAACTGTGTGAGATGGTGCAGCCCAGTGGTGGCCCGGCAGCAGAT
CAGGACGTACTGGGCGAAGAGTCTCCTCTGGGGAAGCCAGCCATGCTGCACCTGCCTTCAGAACAGGGC
GCTCCTGAGACCCTCCAGCGCTGCCTGGAGGAGAATCAAGAGCTCCGAGATGCCATCCGGCAGAGCAAC
CAGATTCTGCGGGAGCGCTGCGAGGAGCTTCTGCATTTCCAAGCCAGCCAGAGGGAGGAGAAGGAGTTC
CTCATGTGCAAGTTCCAGGAGGCCAGGAAACTGGTGGAGAGACTCGGCCTGGAGAAGCTCGATCTGAAG
AGGCAGAAGGAGCAGGCTCTGCGGGAGGTGGAGCACCTGAAGAGATGCCAGCAGCAGATGGCTGAGGAC
AAGGCCTCTGTGAAAGCCCAGGTGACGTCCTTGCTCGGGGAGCTGCAGGAGAGCCAGAGTCGCTTGGAG
GCTGCCACTAAGGAATGCCAGGCTCTGGAGGGTCGGAGGAAGCTGGCCCAGTTGCAGGTGGCCTATCAC
CAGCTCTTCCAAGAATACGACAACCACATCAAGAGCAGCGTGGTGGGCAGTGAGCGGAAGCGAGCGGAT
ATCTACAAGGCGGACTTCCAGGCTGAGAGGCAGGCCCGGGAGAAGCTGGCCGAGAAGAAGGAGCTCCTG
CAGGAGCAGCTGGAGCAGCTGCAGAGGGAGTACAGCAAACTGAAGGCCAGCTGTCAGGAGTCGGCCAGG
ATCGAGGACATGAGGAAGCGGCATGTCGAGGTCTCCCAGGCCCCCTTGCCCCCCGCCCCTGCCTACCTC
TCCTCTCCCCTGGCCCTGCCCAGCCAGAGGAGGAGCCCCCCCGAGGAGCCACCTGACTTCTGCTGTCCC
AAGTGCCAGTATCAGGCCCCTGATATGGACACCCTGCAGATACATGTCATGGAGTGCATTGAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145255
Insert Size 963 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001145255.2
RefSeq Size 1982 bp
RefSeq ORF 963 bp
Locus ID 8517
UniProt ID Q9Y6K9
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Acute myeloid leukemia, Adipocytokine signaling pathway, Apoptosis, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Cytosolic DNA-sensing pathway, Epithelial cell signaling in Helicobacter pylori infection, MAPK signaling pathway, NOD-like receptor signaling pathway, Pancreatic cancer, Pathways in cancer, Primary immunodeficiency, Prostate cancer, RIG-I-like receptor signaling pathway, Small cell lung cancer, T cell receptor signaling pathway, Toll-like receptor signaling pathway
MW 37 kDa
Gene Summary This gene encodes the regulatory subunit of the inhibitor of kappaB kinase (IKK) complex, which activates NF-kappaB resulting in activation of genes involved in inflammation, immunity, cell survival, and other pathways. Mutations in this gene result in incontinentia pigmenti, hypohidrotic ectodermal dysplasia, and several other types of immunodeficiencies. A pseudogene highly similar to this locus is located in an adjacent region of the X chromosome. [provided by RefSeq, Mar 2016]
Transcript Variant: This variant (4) lacks two in-frame exons in the central coding region compared to variant 1. The resulting isoform (c) lacks two internal protein segments compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...