SLC8A3 (NM_001130417) Human Untagged Clone

CAT#: SC325736

SLC8A3 (untagged)-Human solute carrier family 8 (sodium/calcium exchanger), member 3 (SLC8A3), transcript variant g



  "NM_001130417" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-SLC8A3 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NCX3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325736 representing NM_001130417.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAACGTGGAATATCAGATGTGACAGACAGGAAGCTGACTATGGAAGAAGAGGAGGCCAAGAGGATA
GCAGAGATGGGAAAGCCAGTATTGGGTGAACACCCCAAACTAGAAGTCATCATTGAAGAGTCCTATGAG
TTCAAGACTACGGTGGACAAACTGATCAAGAAGACAAACCTGGCCTTGGTTGTGGGGACCCATTCCTGG
AGGGACCAGTTCATGGAGGCCATCACCGTCAGTGCAGCAGGGGATGAGGATGAGGATGAATCCGGGGAG
GAGAGGCTGCCCTCCTGCTTTGACTACGTCATGCACTTCCTGACTGTCTTCTGGAAGGTGCTGTTTGCC
TGTGTGCCCCCCACAGAGTACTGCCACGGCTGGGCCTGCTTCGCCGTCTCCATCCTCATCATTGGCATG
CTCACCGCCATCATTGGGGACCTGGCCTCGCACTTCGGCTGCACCATTGGTCTCAAAGATTCAGTCACA
GCTGTTGTTTTCGTGGCATTTGGCACCTCTGTCCCAGATACGTTTGCCAGCAAAGCTGCTGCCCTCCAG
GATGTATATGCAGACGCCTCCATTGGCAACGTGACGGGCAGCAACGCCGTCAATGTCTTCCTGGGCATC
GGCCTGGCCTGGTCCGTGGCCGCCATCTACTGGGCTCTGCAGGGACAGGAGTTCCACGTGTCGGCCGGC
ACACTGGCCTTCTCCGTCACCCTCTTCACCATCTTTGCATTTGTCTGCATCAGCGTGCTCTTGTACCGA
AGGCGGCCGCACCTGGGAGGGGAGCTTGGTGGCCCCCGTGGCTGCAAGCTCGCCACAACATGGCTCTTT
GTGAGCCTGTGGCTCCTCTACATACTCTTTGCCACACTAGAGGCCTATTGCTACATCAAGGGGTTCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001130417
Insert Size 897 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001130417.2
RefSeq Size 2979 bp
RefSeq ORF 897 bp
Locus ID 6547
UniProt ID P57103
Protein Families Transmembrane
Protein Pathways Calcium signaling pathway
MW 32.7 kDa
Gene Summary This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (g, also known as NCX3-tN.2) differs in the presence and absence of exons at its 5' end, compared to variant c. These differences result in a distinct 5' UTR and translation initiation at a downstream start codon, and an isoform (G) that is shorter than isoform C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...