PSG8 (NM_001130168) Human Untagged Clone

CAT#: SC325734

PSG8 (untagged)-Human pregnancy specific beta-1-glycoprotein 8 (PSG8), transcript variant 3



  "NM_001130168" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PSG8 Antibody - C-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PSG1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325734 representing NM_001130168.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGCTCCTCTCAGCCCCTCCCTGCACACAGCGCATCACCTGGAAGGGGCTCCTGCTCACAGTGGAG
ACTCCCAAGCCCTCCATCTCCAGCAGCAAATTAAACCCCAGGGAGGCCATGGAGGCTGTGAGCTTAACC
TGTGATCCTGAGACTCCGGACGCAAGCTACCTGTGGTGGATGAATGGTCAGAGCCTCCCTATGTCTCAC
AGGTTGCAGTTGTCTGAAACCAACAGGACCCTCTTTCTATTGGGTGTCACAAAGTACACTGCAGGACCC
TATGAATGTGAAATACGGAACCCAGTGAGTGCCAGCCGCAGTGACCCATTCACCCTGAATCTCCTCCCG
AAGCTGCCCAAGCCCTACATCACCATCAACAACTTAAAACCCAGGGAGAATAAGGATGTCTTAAACTTC
ACCTGTGAACCTAAGAGTGAGAACTACACCTACATTTGGTGGCTAAATGGTCAGAGCCTCCCGGTCAGT
CCCAGGGTAAAGCGACCCATTGAAAACAGGATCCTCATTCTACCCAGTGTCACGAGAAATGAAACAGGA
CCCTATCAATGTGAAATAAGGGACCAATATGGTGGCATCCGCAGTTACCCAGTCACCCTGAATGTCCTC
TATGGTCCAGACCTCCCCAGAATTTACCCTTCATTCACCTATTACCGTTCAGGAGAAGTCCTCTACTTG
TCCTGTTCTGCGGACTCTAACCCACCGGCACAGTATTCTTGGACAATTAATGGGAAGTTTCAGCTATCA
GGACAAAAGCTCTTTATCCCCCAAATTACTACAAAGCATAGCGGGCTCTATGCTTGCTCTGTTCGTAAC
TCAGCCACTGGCAAGGAAAGCTCCAAATCCATGACAGTAAAAGTCTCTGACTGGACATTACCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001130168
Insert Size 894 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001130168.1
RefSeq Size 1665 bp
RefSeq ORF 894 bp
Locus ID 440533
UniProt ID Q9UQ74
Protein Families Secreted Protein
MW 33.5 kDa
Gene Summary The human pregnancy-specific glycoproteins (PSGs) are a group of molecules that are mainly produced by the placental syncytiotrophoblasts during pregnancy. PSGs comprise a subgroup of the carcinoembryonic antigen (CEA) family, which belongs to the immunoglobulin superfamily. For additional general information about the PSG gene family, see PSG1 (MIM 176390).[supplied by OMIM, Oct 2009]
Transcript Variant: This variant (3) differs in the 3' UTR and coding sequence and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (c) lacks an alternate internal segment and has a shorter and distinct C-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...