GFI1B (NM_001135031) Human Untagged Clone

CAT#: SC325709

GFI1B (untagged)-Human growth factor independent 1B transcription repressor (GFI1B), transcript variant 2



  "NM_001135031" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal anti-GFI1B antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BDPLT17; ZNF163B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325709 representing NM_001135031.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCACGCTCCTTCCTGGTGAAGAGCAAGAAGGCTCACACCTACCACCAGCCCCGTGTGCAGGAAGAT
GAACCGCTCTGGCCTCCTGCCCTTACCCCGGTGCCCAGAGACCAGGCTCCAAGCAACAGCCCTGTCCTT
AGCACTCTATTCCCAAACCAGTGCCTGGACTGGACCAACCTCAAACGAGAGCCGGAGCTGGAGCAGGAC
CAGAACTTGGCCAGGATGGCCCCGGCACCAGAGGGCCCCATTGTGCTGTCCCGACCCCAGGATGGGGAC
TCTCCACTGTCCGACTCACCCCCATTCTACAAGCCTAGCTTCTCCTGGGACACCTTGGCCACAACCTAT
GGCCACAGCTACCGGCAGGCCCCCTCCACCATGCAGTCAGCCTTCCTGGAGCACTCCGTCAGCCTGTAC
GGCAGTCCTCTTGTGCCCAGCACTGAGCCCGCCTTGGACTTCAGCCTCCGCTACTCCCCAGGCATGGAT
GCGTACCACTGTGTGAAGTGCAACAAGGAGCGCAGCTTCGAGTGCCGCATGTGCGGCAAGGCCTTCAAG
CGCTCGTCCACGCTGTCCACCCACCTGCTCATCCACTCAGACACGCGGCCCTACCCCTGCCAGTTCTGC
GGCAAGCGTTTCCACCAGAAGTCCGACATGAAGAAGCACACCTACATCCACACAGGTGAGAAGCCGCAC
AAGTGCCAGGTGTGCGGAAAGGCCTTCAGCCAGAGCTCCAACCTCATCACCCACAGCCGCAAGCACACA
GGCTTCAAGCCCTTCAGCTGTGAGCTGTGCACCAAAGGCTTCCAGCGCAAGGTGGACCTGCGGCGGCAC
CGCGAGAGCCAGCACAATCTCAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001135031
Insert Size 855 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001135031.1
RefSeq Size 1663 bp
RefSeq ORF 855 bp
Locus ID 8328
UniProt ID Q5VTD9
MW 32.4 kDa
Gene Summary This gene encodes a zinc-finger containing transcriptional regulator that is primarily expressed in cells of hematopoietic lineage. The encoded protein complexes with numerous other transcriptional regulatory proteins including GATA-1, runt-related transcription factor 1 and histone deacetylases to control expression of genes involved in the development and maturation of erythrocytes and megakaryocytes. Mutations in this gene are the cause of the autosomal dominant platelet disorder, platelet-type bleeding disorder-17. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (2) has a shorter 5' UTR and lacks a coding exon, compared to variant 1. The resulting isoform (2) lacks an internal segment compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...