KCNK16 (NM_001135107) Human Untagged Clone

CAT#: SC325680

KCNK16 (untagged)-Human potassium channel, subfamily K, member 16 (KCNK16), transcript variant 4



  "NM_001135107" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms K2p16.1; TALK-1; TALK1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325680 representing NM_001135107.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCCAGTGCTGGGCTCTGCAGCTGCTGGGGTGGCCGGGTGCTGCCCCTGCTGCTGGCCTATGTCTGC
TACCTGCTGCTCGGTGCCACTATCTTCCAGCTGCTAGAGAGGCAGGCGGAGGCTCAGTCCAGGGACCAG
TTTCAGTTGGAGAAGCTGCGCTTCCTGGAGAACTACACCTGCCTGGACCAGTGGGCCATGGAGCAGTTT
GTGCAGGTCATCATGGAAGCCTGGGTGAAAGGTGTGAACCCCAAAGGCAACTCTACCAACCCCAGCAAC
TGGGACTTTGGCAGCAGTTTCTTCTTTGCAGGCACAGTCGTCACTACCATAGGATATGGGAACCTGGCA
CCCAGCACAGAGGCAGGTCAGGTCTTCTGTGTCTTCTATGCCCTGTTGGGCATCCCGCTTAACGTGATC
TTCCTCAACCACCTGGGCACAGGGCTGCGTGCCCATCTGGCCGCCATTGAAAGATGGGAGGACCGTCCC
AGGCGCTCCCAGGTACTGCAAGTCCTGGGCCTGGCTCTGTTCCTGACCCTGGGGACGCTGGTCATTCTC
ATCTTCCCACCCATGGTCTTCAGCCATGTGGAGGGCTGGAGCTTCAGCGAGGGCTTCTACTTTGCTTTC
ATCACTCTCAGCACCATTGGCTTTGGGGACTATGTTGTTGGTCTGAGGCAAGGCTGTGGAGCCAAGGCG
GCTCCAGGCAGGAGACCCAGGAGAGGCTCTACAGCAGCAAGAGGAGTCCAAGTCACACCCCAGGACTTC
CCCATATCCAAGAAAGGACTGGGAAGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001135107
Insert Size 789 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001135107.1
RefSeq Size 1110 bp
RefSeq ORF 789 bp
Locus ID 83795
UniProt ID Q96T55
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
MW 28.8 kDa
Gene Summary The protein encoded by this gene belongs to the family of potassium channel proteins containing two pore-forming P domains. This channel is an open rectifier which primarily passes outward current under physiological K+ concentrations. This gene is expressed predominantly in the pancreas and is activated at alkaline pH. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Sep 2008]
Transcript Variant: This variant (4, also known as TALK-1d) uses a different acceptor splice site at the 3' terminal exon compared to transcript variant 1, resulting in a shorter isoform (4) with a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...