United States
Germany
Japan
United Kingdom
China
TRAF4AF1 (KNSTRN) (NM_001142762) Human Untagged Clone
CAT＃: SC325649
KNSTRN (untagged)-Human chromosome 15 open reading frame 23 (C15orf23), transcript variant 3
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C15orf23; HSD11; SKAP; TRAF4AF1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC325649 representing NM_001142762.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCTCCCGAAGCCCCGCCCCTGGACAGAGTTTTCCGTACAACATGGCTGTCTACAGAGTGCGAT TCCCACCCACTTCCGCCTAGCTACCGGAAGTTTCTATTTGAAACCCAGGCGGCCGACTTAGCCGGTGGC ACGACAGTTGCTGCAGGGAATCTTTTAAACGAGAGCGAGAAGGACTGCGGGCAGGACCGGCGGGCTCCT GGGGTTCAGCCGTGCCGCCTCGTTACGATGACCAGTGTGGTTAAGACAGTGTATAGCCTGCAGCCCCCC TCTGCGCTGAGCGGCGGCCAGCCGGCAGACACACAAACTCGGGCCACTTCTAAGAGTCTCTTACCTGTT AGGTCCAAAGAAGTCGATGTTTCCAAACAGCTTCATTCAGGAGGTCCAGAGAATGATGTTACAAAAATC ACCAAACTGAGACGAGAGAATGGGCAAATGAAAGCTACTGACACTGCCACCAGAAGGAATGTCAGAAAA GGCTACAAACCACTGAGTAAGCAAAAATCAGAGGAAGAGCTCAAGGACAAGAACCAGCTGTTAGAAGCC GTCAACAAGCAGTTGCACCAGAAGTTGACTGAAACTCAGGGAGAGCTGAAGGACCTGACCCAGAAGGTA GAGCTGCTGGAGAAGTTTCGGGACAACTGTTTGGCAATTTTGGAGAGCAAGGGCCTTGATCCAGTTGCT GTTAGAAACTTTGCAAGAGGAGCTGAAGCTTTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001142762 |
| Insert Size | 726 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001142762.1 |
| RefSeq Size | 1701 bp |
| RefSeq ORF | 726 bp |
| Locus ID | 90417 |
| UniProt ID | Q9Y448 |
| MW | 26.6 kDa |
| Gene Summary | Essential component of the mitotic spindle required for faithful chromosome segregation and progression into anaphase (PubMed:19667759). Promotes the metaphase-to-anaphase transition and is required for chromosome alignment, normal timing of sister chromatid segregation, and maintenance of spindle pole architecture (PubMed:19667759, PubMed:22110139). The astrin (SPAG5)-kinastrin (SKAP) complex promotes stable microtubule-kinetochore attachments (PubMed:21402792). Required for kinetochore oscillations and dynamics of microtubule plus-ends during live cell mitosis, possibly by forming a link between spindle microtubule plus-ends and mitotic chromosomes to achieve faithful cell division (PubMed:23035123). May be involved in UV-induced apoptosis via its interaction with PRPF19; however, these results need additional evidences (PubMed:24718257).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 3' UTR and lacks an alternate exon in the 3' coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (c) has a shorter and distinct C-terminus, compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227425 | KNSTRN (Myc-DDK-tagged)-Human chromosome 15 open reading frame 23 (C15orf23), transcript variant 3 |
CNY 3,600.00 |
|
| RC227425L3 | Lenti ORF clone of Human chromosome 15 open reading frame 23 (C15orf23), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC227425L4 | Lenti ORF clone of Human chromosome 15 open reading frame 23 (C15orf23), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG227425 | KNSTRN (tGFP-tagged) - Human chromosome 15 open reading frame 23 (C15orf23), transcript variant 3 |
CNY 5,200.00 |
其它TRAF4AF1产品
