NECAP2 (NM_001145278) Human Untagged Clone

CAT#: SC325645

NECAP2 (untagged)-Human NECAP endocytosis associated 2 (NECAP2), transcript variant 3



  "NM_001145278" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-NECAP2 Antibody - N-terminal region
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325645 representing NM_001145278.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGAGAGCGGGGCTGCGGAGTGGCAGCTGGACCAGCCATCATGGAGTGGCCGGCTGAGGATCACT
GCAAAGGGACAGATGGCCTACATCAAGCTGGAGGACAGGACGTCAGGGGAGCTCTTTGCTCAGGCCCCG
GTGGATCAGTTTCCTGGCACAGCTGTGGAGAGTGTGACGGATTCCAGCAGGTACTTCGTGATCCGCATC
GAAGATGGAAATGGGCGACGGGCGTTTATTGGAATTGGCTTCGGGGACCGAGGTGATGCCTTTGACTTC
AATGTTGCATTGCAGGACCATTTCAAGTGGGTGAAACAGCAGTGTGAATTTGCAAAACAAGCCCAGAAC
CCAGACCAAGGCCCTAAACTGGACCTGGGCTTCAAGGAGGGCCAGACCATCAAGCTCAACATCGCAAAC
ATGAAGAAGAAGGAAGGAGCAGCTGGGAATCCCCGAGTCCGGCCTGCCAGCACAGGAGGGCTGAGCCTG
CTTCCCCCTCCCCCAGGGGGGAAAACCTCCACCCTGATCCCTCCCCCTGGGGAGCAGTTGGCTGTGGGG
GGATCCCTCGTCCAGCCAGCAGTTGCTCCCAGTTCAGGAGGTGCTCCTGTACCCTGGCCACAGCCCAAT
CCTGCCACTGCTGACATCTGGGGAGACTTTACCAAATCTACAGGATCAACTTCCAGCCAGACCCAGCCA
GGCACAGGCTGGGTCCAGTTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145278
Insert Size 714 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001145278.1
RefSeq Size 2014 bp
RefSeq ORF 714 bp
Locus ID 55707
UniProt ID Q9NVZ3
MW 25.3 kDa
Gene Summary This gene likely encodes a member of the adaptin-ear-binding coat-associated protein family. Studies of a similar protein in rat suggest a role in clathrin-mediated endocytosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Transcript Variant: This variant (3) uses an alternate in-frame splice site in the 5' coding region compared to variant 1. This results in a shorter protein (isoform 3) compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...