DMRT2 (NM_001130865) Human Untagged Clone
CAT#: SC325629
DMRT2 (untagged)-Human doublesex and mab-3 related transcription factor 2 (DMRT2), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DSXL-2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001130865, the custom clone sequence may differ by one or more nucleotides
ATGGCCGACCCGCAGGCTGGCTCCGCGGCCGGGGACTGGGAGATCGATGTCGAGAGCCTG GAGCTGGAAGAGGACGTCTGCGGGGCGCCGCGGTCCACGCCCCCCGGGCCCAGCCCGCCG CCGGCGGACGGGGACTGCGAGGACGACGAAGATGACGACGGGGTGGACGAAGACGCGGAA GAAGAGGGCGACGGCGAGGAGGCAGGCGCGTCCCCCGGGATGCCCGGCCAGCCGGAGCAG CGGGGGGGACCGCAGCCGAGGCCGCCGCTCGCGCCTCAGGCCTCACCCGCCGGCACCGGT CCCCGAGAGCGCTGCACTCCCGCGGGCGGCGGCGCGGAGCCGCGCAAGCTGAGCCGCACG CCCAAGTGCGCGCGCTGCCGCAACCACGGCGTGGTGTCCTGCCTGAAGGGCCACAAGCGC TTCTGTCGCTGGCGCGACTGCCAGTGCGCCAACTGCCTGCTGGTGGTGGAGCGGCAGCGC GTCATGGCCGCCCAGGTGGCGCTCCGGAGGCAGCAGGCCACCGAGGACAAGAAGGGGCTT TCCGGGAAACAGAATAATTTCGAGCGCAAAGCTGTGTACCAGAGGCAAGTCAGAGCCCCC AGTTTGCTGGCCAAAAGCATTTTAGAAGTTCTCCTTGGATTATTCTACAGCTATTATGTG TACATAATGAACCATCTT |
Restriction Sites | Please inquire |
ACCN | NM_001130865 |
Insert Size | 2383 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001130865.1, NP_001124337.1 |
RefSeq Size | 2383 bp |
RefSeq ORF | 681 bp |
Locus ID | 10655 |
UniProt ID | Q9Y5R5 |
Protein Families | Transcription Factors, Transmembrane |
Gene Summary | The protein encoded by this gene belongs to the DMRT gene family, sharing a DM DNA-binding domain with Drosophila 'doublesex' (dsx) and C. elegans mab3, genes involved in sex determination in these organisms. Also, this gene is located in a region of the human genome (chromosome 9p24.3) associated with gonadal dysgenesis and XY sex reversal. Hence this gene is one of the candidates for sex-determining gene(s) on chr 9. [provided by RefSeq, Apr 2010] Transcript Variant: This variant (2) differs at the 5' and 3' ends compared to variant 1. Variants 1, 2, 4, and 6 all encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225278 | DMRT2 (Myc-DDK-tagged)-Human doublesex and mab-3 related transcription factor 2 (DMRT2), transcript variant 2 |
CNY 3,990.00 |
|
RC225278L3 | Lenti-ORF clone of DMRT2 (Myc-DDK-tagged)-Human doublesex and mab-3 related transcription factor 2 (DMRT2), transcript variant 2 |
CNY 5,890.00 |
|
RC225278L4 | Lenti-ORF clone of DMRT2 (mGFP-tagged)-Human doublesex and mab-3 related transcription factor 2 (DMRT2), transcript variant 2 |
CNY 5,890.00 |
|
RG225278 | DMRT2 (tGFP-tagged) - Human doublesex and mab-3 related transcription factor 2 (DMRT2), transcript variant 2 |
CNY 4,370.00 |