WIBG (PYM1) (NM_001143853) Human Untagged Clone
CAT#: SC325597
WIBG (untagged)-Human within bgcn homolog (Drosophila) (WIBG), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PYM; WIBG |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325597 representing NM_001143853.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGACTCCCTATGTTACTGACGAGACCGGCGGCAAGTATATCGCGTCAACACAGCGACCTGACGGG ACCTGGCGCAAGCAGCGGAGGGTGAAAGAAGGATATGTGCCCCAGGAGGAGGTCCCAGTATATGAAAAC AAGTATGTGAAGTTTTTCAAGAGTAAACCAGAGTTGCCCCCAGGGCTAAGCCCTGAGGCCACTGCTCCT GTCACCCCATCCAGGCCTGAAGGTGGTGAACCAGGCCTCTCCAAGACAGCCAAACGTAACCTGAAGCGA AAGGAGAAGAGGCGGCAGCAGCAAGAGAAAGGAGAGGCAGAGGCCTTGAGCAGGACTCTTGATAAGGTG TCCCTGGAAGAGACAGCCCAACTCCCCAGTGCTCCACAGGGCTCTCGGGCAGCCCCCACAGCTGCATCT GACCAGCCTGACTCAGCTGCCACCACTGAGAAAGCCAAGAAGATAAAGAACCTAAAGAAGAAACTCCGG CAGGTGGAAGAGCTGCAGCAGCGGATCCAGGCTGGGGAAGTCAGCCAGCCCAGCAAAGAGCAGCTAGAA AAGCTAGCAAGGAGGAGGGCGCTAGAAGAGGAGTTAGAGGACTTGGAGTTAGGCCTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001143853 |
Insert Size | 612 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001143853.1 |
RefSeq Size | 1105 bp |
RefSeq ORF | 612 bp |
Locus ID | 84305 |
UniProt ID | Q9BRP8 |
MW | 22.7 kDa |
Gene Summary | Key regulator of the exon junction complex (EJC), a multiprotein complex that associates immediately upstream of the exon-exon junction on mRNAs and serves as a positional landmark for the intron exon structure of genes and directs post-transcriptional processes in the cytoplasm such as mRNA export, nonsense-mediated mRNA decay (NMD) or translation. Acts as an EJC disassembly factor, allowing translation-dependent EJC removal and recycling by disrupting mature EJC from spliced mRNAs. Its association with the 40S ribosomal subunit probably prevents a translation-independent disassembly of the EJC from spliced mRNAs, by restricting its activity to mRNAs that have been translated. Interferes with NMD and enhances translation of spliced mRNAs, probably by antagonizing EJC functions. May bind RNA; the relevance of RNA-binding remains unclear in vivo, RNA-binding was detected by PubMed:14968132, while PubMed:19410547 did not detect RNA-binding activity independently of the EJC.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is 1 aa shorter and has a distinct N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227106 | WIBG (Myc-DDK-tagged)-Human within bgcn homolog (Drosophila) (WIBG), transcript variant 2 |
CNY 2,400.00 |
|
RC227106L1 | Lenti ORF clone of Human within bgcn homolog (Drosophila) (WIBG), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC227106L2 | Lenti ORF clone of Human within bgcn homolog (Drosophila) (WIBG), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC227106L3 | Lenti ORF clone of Human within bgcn homolog (Drosophila) (WIBG), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC227106L4 | Lenti ORF clone of Human within bgcn homolog (Drosophila) (WIBG), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG227106 | WIBG (tGFP-tagged) - Human within bgcn homolog (Drosophila) (WIBG), transcript variant 2 |
CNY 4,370.00 |