United States
Germany
Japan
United Kingdom
China
FGF13 (NM_001139498) Human Untagged Clone
CAT＃: SC325591
FGF13 (untagged)-Human fibroblast growth factor 13 (FGF13), transcript variant 4
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DEE90; FGF-13; FGF2; FHF-2; FHF2; LINC00889 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001139498, the custom clone sequence may differ by one or more nucleotides
ATGAGTGGAAAGGTGACCAAGCCCAAAGAGGAGAAAGATGCTTCTAAGGAGCCTCAGCTT AAGGGTATAGTTACCAAGCTATACAGCCGACAAGGCTACCACTTGCAGCTGCAGGCGGAT GGAACCATTGATGGCACCAAAGATGAGGACAGCACTTACACTCTGTTTAACCTCATCCCT GTGGGTCTGCGAGTGGTGGCTATCCAAGGAGTTCAAACCAAGCTGTACTTGGCAATGAAC AGTGAGGGATACTTGTACACCTCGGAACTTTTCACACCTGAGTGCAAATTCAAAGAATCA GTGTTTGAAAATTATTATGTGACATATTCATCAATGATATACCGTCAGCAGCAGTCAGGC CGAGGGTGGTATCTGGGTCTGAACAAAGAAGGAGAGATCATGAAAGGCAACCATGTGAAG AAGAACAAGCCTGCAGCTCATTTTCTGCCTAAACCACTGAAAGTGGCCATGTACAAGGAG CCATCACTGCACGATCTCACGGAGTTCTCCCGATCTGGAAGCGGGACCCCAACCAAGAGC AGAAGTGTCTCTGGCGTGCTGAACGGAGGCAAATCCATGAGCCACAATGAATCAACG |
| Restriction Sites | Please inquire |
| ACCN | NM_001139498 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001139498.1, NP_001132970.1 |
| RefSeq Size | 2172 bp |
| RefSeq ORF | 600 bp |
| Locus ID | 2258 |
| UniProt ID | Q92913 |
| Protein Families | Secreted Protein |
| Protein Pathways | MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton |
| Gene Summary | The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. This gene is located in a region on chromosome X, which is associated with Borjeson-Forssman-Lehmann syndrome (BFLS), making it a possible candidate gene for familial cases of the BFLS, and for other syndromal and nonspecific forms of X-linked cognitive disability mapping to this region. Alternative splicing of this gene at the 5' end results in several transcript variants encoding different isoforms with different N-termini. [provided by RefSeq, Nov 2008] Transcript Variant: This variant (4) contains two additional exons at the 5' end compared to transcript variant 1. This results in a shorter isoform (4) with a different N-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227490 | FGF13 (Myc-DDK-tagged)-Human fibroblast growth factor 13 (FGF13), transcript variant 4 |
CNY 3,990.00 |
|
| RC227490L3 | Lenti-ORF clone of FGF13 (Myc-DDK-tagged)-Human fibroblast growth factor 13 (FGF13), transcript variant 4 |
CNY 5,890.00 |
|
| RC227490L4 | Lenti-ORF clone of FGF13 (mGFP-tagged)-Human fibroblast growth factor 13 (FGF13), transcript variant 4 |
CNY 5,890.00 |
|
| RG227490 | FGF13 (tGFP-tagged) - Human fibroblast growth factor 13 (FGF13), transcript variant 4 |
CNY 4,370.00 |
