United States
Germany
Japan
United Kingdom
China
MAD3 (MXD3) (NM_001142935) Human Untagged Clone
CAT＃: SC325583
MXD3 (untagged)-Human MAX dimerization protein 3 (MXD3), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BHLHC13; MAD3; MYX |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001142935 edited
GCTTGCTCCGGCCGGCACCCTAGGCCGGCCCGCCGCCAGCTGTCGCCGACATGGAACCCT TGGCCAGCAACATCCAGGTCCTGCTGCAGGCGGCCGAGTTCCTGGAGCGCCGTGAGAGAG AGGCCGAGCATGGTTATGCGTCCCTGTGCCCGCATCGCAGTCCAGGCCCCATCCACAGGA GGAAGAAGCGACCCCCCCAGGCTCCTGGCGCGCAGGACAGCGGGCGGTCAGTGCACAATG AACTGGAGAAGCGCAGGAGGGCCCAGTTGAAGCGGTGCCTGGAGCGGCTGAAGCAGCAGA TGCCCCTGGGGGCCGACTGTGCCCGGTACACCACGCTGAGCCTGCTGCGCCGTGCCAGGA TGCACATCCAGAAGCTGGAGGATCAGGAGCAGCGGGCCCGACAGCTCAAGGAGAGGCTGC GCAGCAAGCAGCAGAGCCTGCAGCGGCAGCTGGAGCAGCTCCGGGGGCTGGCAGGGGCGG CCGAGCGGGAGCGGCTGCGGGCGGACAGTCTGGACTCCTCAGGCCTCTCCTCTGAGCGCT CAGACTCAGACCAAGTCTTGCCTAATGAAAACGGGGGAACTCCCAACCACAGACCCACTG GAAGAGGAAATAATATCAGTTCCCATCACTGAC |
| Restriction Sites | Please inquire |
| ACCN | NM_001142935 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001142935.1, NP_001136407.1 |
| RefSeq Size | 2662 bp |
| RefSeq ORF | 582 bp |
| Locus ID | 83463 |
| UniProt ID | Q9BW11 |
| Protein Families | Druggable Genome, Transcription Factors |
| Gene Summary | This gene encodes a member of the Myc superfamily of basic helix-loop-helix leucine zipper transcriptional regulators. The encoded protein forms a heterodimer with the cofactor MAX which binds specific E-box DNA motifs in the promoters of target genes and regulates their transcription. Disruption of the MAX-MXD3 complex is associated with uncontrolled cell proliferation and tumorigenesis. Transcript variants of this gene encoding different isoforms have been described.[provided by RefSeq, Dec 2008] Transcript Variant: This variant (2) differs in the 3' UTR and 3' coding region compared to variant 1. The resulting isoform (b) has a distinct C-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227362 | MXD3 (Myc-DDK-tagged)-Human MAX dimerization protein 3 (MXD3), transcript variant 2 |
CNY 2,400.00 |
|
| RC227362L3 | Lenti ORF clone of Human MAX dimerization protein 3 (MXD3), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC227362L4 | Lenti ORF clone of Human MAX dimerization protein 3 (MXD3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG227362 | MXD3 (tGFP-tagged) - Human MAX dimerization protein 3 (MXD3), transcript variant 2 |
CNY 4,000.00 |
