United States
Germany
Japan
United Kingdom
China
CD164 (NM_001142401) Human Untagged Clone
CAT＃: SC325574
CD164 (untagged)-Human CD164 molecule, sialomucin (CD164), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DFNA66; endolyn; MGC-24; MGC-24v; MUC-24 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001142401, the custom clone sequence may differ by one or more nucleotides
ATGTCGCGGCTCTCCCGCTCACTGCTTTGGGCCGCCACCTGCCTGGGCGTGCTCTGCGTG CTGTCCGCGGACAAGAACACGACCCAGCACCCGAACGTGACGACTTTAGCGCCCATCTCC AACGTAACCTCGGCGCCGGTGACGTCCCTCCCGCTGGTCACCACTCCGGCACCAGAAACC TGTGAAGGTCGAAACAGCTGCGTTTCCTGTTTTAATGTTAGCGTTGTTAATACTACCTGC TTTTGGATAGAATGTAAAGATGAGAGCTATTGTTCACATAACTCAACAGTTAGTGATTGT CAAGTGGGGAACACGACAGACTTCTGTTCCGCTAAACCCACAGTTCAGCCCTCCCCTTCT ACAACTTCCAAGACAGTTACTACATCAGGTACAACAAATAACACTGTGACTCCAACCTCA CAACCTGTGCGAAAGTCTACCTTTGATGCAGCCAGTTTCATTGGAGGAATTGTCCTGGTC TTGGGTGTGCAGGCTGTAATTTTCTTTCTTTATAAATTCTGCAAATCTAAAGAACGAAAT TACCACACTCTG |
| Restriction Sites | Please inquire |
| ACCN | NM_001142401 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001142401.1, NP_001135873.1 |
| RefSeq Size | 3089 bp |
| RefSeq ORF | 555 bp |
| Locus ID | 8763 |
| UniProt ID | Q04900 |
| Protein Families | Secreted Protein, Transmembrane |
| Protein Pathways | Lysosome |
| Gene Summary | This gene encodes a transmembrane sialomucin and cell adhesion molecule that regulates the proliferation, adhesion and migration of hematopoietic progenitor cells. The encoded protein also interacts with the C-X-C chemokine receptor type 4 and may regulate muscle development. Elevated expression of this gene has been observed in human patients with Sezary syndrome, a type of blood cancer, and a mutation in this gene may be associated with impaired hearing. [provided by RefSeq, Oct 2016] Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. It encodes isoform 2 which is shorter than isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226592 | CD164 (Myc-DDK-tagged)-Human CD164 molecule, sialomucin (CD164), transcript variant 2 |
CNY 3,990.00 |
|
| RC226592L3 | Lenti-ORF clone of CD164 (Myc-DDK-tagged)-Human CD164 molecule, sialomucin (CD164), transcript variant 2 |
CNY 5,890.00 |
|
| RC226592L4 | Lenti-ORF clone of CD164 (mGFP-tagged)-Human CD164 molecule, sialomucin (CD164), transcript variant 2 |
CNY 5,890.00 |
|
| RG226592 | CD164 (tGFP-tagged) - Human CD164 molecule, sialomucin (CD164), transcript variant 2 |
CNY 4,370.00 |
