ARFRP1 (NM_001134758) Human Untagged Clone
CAT#: SC325555
ARFRP1 (untagged)-Human ADP-ribosylation factor related protein 1 (ARFRP1), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARL18; ARP; Arp1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325555 representing NM_001134758.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTACACGCTGCTGTCGGGCTTGTACAAGTACATGTTTCAGAAGGACGAGTACTGCATCCTGATCCTG GGCCTGGACAATGCTGGGAAGACGACCTTCCTGGAGCAGTCGAAAACCCGATTTAACAAGAACTACAAG GGGATGAGTCTATCCAAAATCACCACCACCGTGGGCCTAAACATCGGCACTGTGGATGTGGGAAAGGCT CGGCTCATGTTCTGGGACTTAGGAGGGCAGGAAGAGCTGCAGTCTTTGTGGGACAAGTATTATGCGGAG TGTCACGGCGTCATCTACGTCATTGACTCCACCGACGAGGAGAGGCTGGCTGAGTCCAAGCAGGCGTTT GAGAAGGTGGTGACCAGCGAGGCGCTGTGCGGTGTCCCCGTCTTGGTGCTGGCCAACAAGCAGGATGTG GAGACGTGCCTCTCAATCCCTGACATCAAGACGGCCTTCAGCGACTGCACCAGCAAGATCGGCAGGCGA GATTGCCTGACCCAGGCCTGCTCGGCCCTCACAGGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001134758 |
Insert Size | 522 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001134758.3 |
RefSeq Size | 2642 bp |
RefSeq ORF | 522 bp |
Locus ID | 10139 |
UniProt ID | Q13795 |
MW | 19.3 kDa |
Gene Summary | The protein encoded by this gene is a membrane-associated GTP-ase which localizes to the plasma membrane and is related to the ADP-ribosylation factor (ARF) and ARF-like (ARL) proteins. This gene plays a role in membrane trafficking between the trans-Golgi network and endosomes. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012] Transcript Variant: This variant (2) contains an alternate segment in the 3' terminal exon, compared to variant 1, which results in the introduction of an early stop codon and a protein (isoform B) with a shorter C-terminus, compared to isoform 1. Variants 2 and 8 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225177 | ARFRP1 (Myc-DDK-tagged)-Human ADP-ribosylation factor related protein 1 (ARFRP1), transcript variant 2 |
CNY 2,400.00 |
|
RC225177L3 | Lenti ORF clone of Human ADP-ribosylation factor related protein 1 (ARFRP1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225177L4 | Lenti ORF clone of Human ADP-ribosylation factor related protein 1 (ARFRP1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG225177 | ARFRP1 (tGFP-tagged) - Human ADP-ribosylation factor related protein 1 (ARFRP1), transcript variant 2 |
CNY 4,370.00 |