United States
Germany
Japan
United Kingdom
China
p53 DINP1 (TP53INP1) (NM_001135733) Human Untagged Clone
CAT＃: SC325541
TP53INP1 (untagged)-Human tumor protein p53 inducible nuclear protein 1 (TP53INP1), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | p53DINP1; SIP; Teap; TP53DINP1; TP53INP1A; TP53INP1B |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC325541 representing NM_001135733.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTCCAGAGGCTGAATAAAATGTTTGTGGGTGAAGTCAGTTCTTCCTCCAACCAAGAACCAGAATTC AATGAGAAAGAAGATGATGAATGGATTCTTGTTGACTTCATAGATACTTGCACTGGTTTCTCAGCAGAA GAAGAAGAAGAAGAGGAGGACATCAGTGAAGAGTCACCTACTGAGCACCCTTCAGTCTTTTCCTGTTTA CCGGCATCTCTTGAGTGCTTGGCTGATACAAGTGATTCCTGCTTTCTCCAGTTTGAGTCATGTCCAATG GAGGAGAGCTGGTTTATCACCCCACCCCCATGTTTTACTGCAGGTGGATTAACCACTATCAAGGTGGAA ACAAGTCCTATGGAAAACCTTCTCATTGAACATCCCAGCATGTCTGTCTATGCTGTGCATAACTCCTGC CCTGGTCTCAGTGAGGCCACCCGTGGGACTGATGAATTACATAGCCCAAGTAGTCCCAGGGCCAGGAAA AGCTGCTTATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001135733 |
| Insert Size | 495 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001135733.1 |
| RefSeq Size | 5666 bp |
| RefSeq ORF | 495 bp |
| Locus ID | 94241 |
| UniProt ID | Q96A56 |
| Protein Families | Druggable Genome |
| MW | 18.2 kDa |
| Gene Summary | Antiproliferative and proapoptotic protein involved in cell stress response which acts as a dual regulator of transcription and autophagy. Acts as a positive regulator of autophagy. In response to cellular stress or activation of autophagy, relocates to autophagosomes where it interacts with autophagosome-associated proteins GABARAP, GABARAPL1/L2, MAP1LC3A/B/C and regulates autophagy. Acts as an antioxidant and plays a major role in p53/TP53-driven oxidative stress response. Possesses both a p53/TP53-independent intracellular reactive oxygen species (ROS) regulatory function and a p53/TP53-dependent transcription regulatory function. Positively regulates p53/TP53 and p73/TP73 and stimulates their capacity to induce apoptosis and regulate cell cycle. In response to double-strand DNA breaks, promotes p53/TP53 phosphorylation on 'Ser-46' and subsequent apoptosis. Acts as a tumor suppressor by inducing cell death by an autophagy and caspase-dependent mechanism. Can reduce cell migration by regulating the expression of SPARC.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains an alternate exon compared to variant 1 that has an in-frame stop codon in it. The resulting isoform (b) has a shorter and distinct C-terminus compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226626 | TP53INP1 (Myc-DDK-tagged)-Human tumor protein p53 inducible nuclear protein 1 (TP53INP1), transcript variant 2 |
CNY 1,200.00 |
|
| RC226626L3 | Lenti ORF clone of Human tumor protein p53 inducible nuclear protein 1 (TP53INP1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC226626L4 | Lenti ORF clone of Human tumor protein p53 inducible nuclear protein 1 (TP53INP1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG226626 | TP53INP1 (tGFP-tagged) - Human tumor protein p53 inducible nuclear protein 1 (TP53INP1), transcript variant 2 |
CNY 4,370.00 |
其它p53 DINP1产品
