United States
Germany
Japan
United Kingdom
China
STRA6 (NM_001142620) Human Untagged Clone
CAT＃: SC325534
STRA6 (untagged)-Human stimulated by retinoic acid gene 6 homolog (mouse) (STRA6), transcript variant 5
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MCOPCB8; MCOPS9; PP14296 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001142620, the custom clone sequence may differ by one or more nucleotides
ATGTCGTCCCAGCCAGCAGGGAACCAGACCTCCCCCGGGGCCACAGAGGACTACTCCTAT GGCAGCTGGTACATCGATGAGCCCCAGGGGGGCGAGGAGCTCCAGCCAGAGGGGGAAGTG CCCTCCTGCCACACCAGCATACCACCCGGCCTGTACCACGCCTGCCTGGCCTCGCTGTCA ATCCTTGTGCTGCTGCTCCTGGCCATGCTGGTGAGGCGCCGCCAGCTCTGGCCTGACTGT GTGCGTGGCAGGCCCGGCCTGCCCAGCCCTGTGGATTTCTTGGCTGGGGACAGGCCCCGG GCAGTGCCTGCTGCTGTTTTCATGGTCCTCCTGAGCTCCCTGTGTTTGCTGCTCCCCGAC GAGGACGCATTGCCCTTCCTGACTCTCGCCTCAGCACCCAGCCAAGATGGGAAAACTGAG GCTCCAAGAGGTAACTTGCCCAAGATCACAGAGTTGAGACTAGTCAGAGCCTGGATT |
| Restriction Sites | Please inquire |
| ACCN | NM_001142620 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001142620.1, NP_001136092.1 |
| RefSeq Size | 1956 bp |
| RefSeq ORF | 480 bp |
| Locus ID | 64220 |
| UniProt ID | Q9BX79 |
| Protein Families | Transmembrane |
| Gene Summary | The protein encoded by this gene is a membrane protein involved in the metabolism of retinol. The encoded protein acts as a receptor for retinol/retinol binding protein complexes. This protein removes the retinol from the complex and transports it across the cell membrane. Defects in this gene are a cause of syndromic microphthalmia type 9 (MCOPS9). Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2008] Transcript Variant: This variant (5) differs in the 3' UTR and coding sequence compared to variant 8. The resulting isoform (c) has a shorter and distinct C-terminus compared to isoform f. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227536 | STRA6 (Myc-DDK-tagged)-Human stimulated by retinoic acid gene 6 homolog (mouse) (STRA6), transcript variant 5 |
CNY 3,990.00 |
|
| RC227536L3 | Lenti-ORF clone of STRA6 (Myc-DDK-tagged)-Human stimulated by retinoic acid gene 6 homolog (mouse) (STRA6), transcript variant 5 |
CNY 5,890.00 |
|
| RC227536L4 | Lenti-ORF clone of STRA6 (mGFP-tagged)-Human stimulated by retinoic acid gene 6 homolog (mouse) (STRA6), transcript variant 5 |
CNY 5,890.00 |
|
| RG227536 | STRA6 (tGFP-tagged) - Human stimulated by retinoic acid gene 6 homolog (mouse) (STRA6), transcript variant 5 |
CNY 4,370.00 |
