DAZAP2 (NM_001136269) Human Untagged Clone

CAT#: SC325524

DAZAP2 (untagged)-Human DAZ associated protein 2 (DAZAP2), transcript variant 6



  "NM_001136269" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-DAZAP2 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PRTB
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001136269, the custom clone sequence may differ by one or more nucleotides
ATGAACAGCAAAGGTCAATATCCAACACAGCCAACCTACCCTGTGCAGCCTCCTGGGAAT
CCAGTATACCCTCAGACCTTGCATCTTCCTCAGGCTCCACCCTATACCGATGCTCCACCT
GCCTACTCAGAGCTCTATCGTCCGAGCTTTGTGCACCCAGGGGCTGCCACAGTCCCCACC
ATGTCAGCCGCATTTCCTGGAGCCTCTCTGTATCTTCCCATGGCCCAGTCTGTGGCTGTT
GGGCCTTTAGGTTCCACAATCCCCATGGCTTATTATCCAGTCGGTCCCATCTATCCACCT
GGCTCCACAGTGCTGGTGGAAGGAGGGTATGATGCAGGTGCCAGATTTGGAGCTGGGGCT
ACTGCTGGCAACATTCCTGTAAAAGAAGATCAAGATCACGACCGAGAGCAGGGTGAGGAA
GACAACGGTGATAACAACTTGGAAAGGAGAGGGAAAATG
Restriction Sites Please inquire     
ACCN NM_001136269
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001136269.1, NP_001129741.1
RefSeq Size 1219 bp
RefSeq ORF 462 bp
Locus ID 9802
UniProt ID Q15038
Gene Summary This gene encodes a proline-rich protein which interacts with the deleted in azoospermia (DAZ) and the deleted in azoospermia-like gene through the DAZ-like repeats. This protein also interacts with the transforming growth factor-beta signaling molecule SARA (Smad anchor for receptor activation), eukaryotic initiation factor 4G, and an E3 ubiquitinase that regulates its stability in splicing factor containing nuclear speckles. The encoded protein may function in various biological and pathological processes including spermatogenesis, cell signaling and transcription regulation, formation of stress granules during translation arrest, RNA splicing, and pathogenesis of multiple myeloma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (6) uses an alternate exon in the 3' coding region, compared to variant 1. The resulting protein (isoform f) is shorter and has a distinct C-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...