United States
Germany
Japan
United Kingdom
China
URM1 (NM_001135947) Human Untagged Clone
CAT＃: SC325517
URM1 (untagged)-Human ubiquitin related modifier 1 (URM1), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C9orf74 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001135947, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCGCCCTTGTCAGTGGAGGTGGAGTTCGGAGGTGGTGCGGAGCTCCTGTTTGAC GGTATTAAGAAACATCGAGTCACTTTGCCTGGACAGGAGGAACCCTGGGACATCCGGAAC CTGCTCATCTGGATCAAGAAGAATTTGCTAAAAGAGCGGCCAGAGTTGTTCATCCAGGGA GACAGCGTGCGGCCAGGAATTCTGGTGCTGATTAACGATGCCGACTGGGAGCTACTGGTC AGTACCTTGGGGGACATCCCTCCCCCAGCCCCTGCCCTTGCTGCTTCAGTGGGAAAGCGT TGGGCCTCTCCTCAGGCACATATAGAGTGGCTGGGTAATCCTCCGCCCCACTCCAGCCCC ACACTGAGGCTGCTGGAGTCTCCCACTCCAGGTGAGGAAGGGATGGGTAGCTGGGGACAT GGGAGTACTCCTCCATCC |
| Restriction Sites | Please inquire |
| ACCN | NM_001135947 |
| Insert Size | 3006 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001135947.1, NP_001129419.1 |
| RefSeq Size | 3006 bp |
| RefSeq ORF | 3006 bp |
| Locus ID | 81605 |
| UniProt ID | Q9BTM9 |
| Gene Summary | Acts as a sulfur carrier required for 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of cytosolic tRNA(Lys), tRNA(Glu) and tRNA(Gln). Serves as sulfur donor in tRNA 2-thiolation reaction by being thiocarboxylated (-COSH) at its C-terminus by MOCS3. The sulfur is then transferred to tRNA to form 2-thiolation of mcm(5)S(2)U. Also acts as a ubiquitin-like protein (UBL) that is covalently conjugated via an isopeptide bond to lysine residues of target proteins such as MOCS3, ATPBD3, CTU2, USP15 and CAS. The thiocarboxylated form serves as substrate for conjugation and oxidative stress specifically induces the formation of UBL-protein conjugates.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) encodes the longest isoform (B). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227597 | URM1 (Myc-DDK-tagged)-Human ubiquitin related modifier 1 (URM1), transcript variant 2 |
CNY 3,990.00 |
|
| RC227597L3 | Lenti-ORF clone of URM1 (Myc-DDK-tagged)-Human ubiquitin related modifier 1 (URM1), transcript variant 2 |
CNY 5,890.00 |
|
| RC227597L4 | Lenti-ORF clone of URM1 (mGFP-tagged)-Human ubiquitin related modifier 1 (URM1), transcript variant 2 |
CNY 5,890.00 |
|
| RG227597 | URM1 (tGFP-tagged) - Human ubiquitin related modifier 1 (URM1), transcript variant 2 |
CNY 4,370.00 |
