CSRP1 (NM_001144773) Human Untagged Clone

CAT#: SC325511

CSRP1 (untagged)-Human cysteine and glycine-rich protein 1 (CSRP1), transcript variant 2



  "NM_001144773" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal anti-CRP1 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CRP; CRP1; CSRP; CYRP; cysteine-rich protein; cysteine and glycine-rich protein 1; D1S181E; DKFZp686M148; LIM-domain protein; OTTHUMP00000033921
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325511 representing NM_001144773.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCGAACTGGGGAGGAGGCAAGAAATGTGGGGTGTGTCAGAAGACGGTTTACTTTGCCGAAGAGGTT
CAGTGCGAAGGCAACAGCTTCCATAAATCCTGCTTCCTGTGCATGGTCTGCAAGAAGAATCTGGACAGT
ACCACTGTGGCCGTGCATGGTGAGGAGATTTACTGCAAGTCCTGCTACGGCAAGAAGTATGGGCCCAAA
GGCTATGGCTACGGGCAGGGCGCAGGCACCCTCAGCACTGACAAGGGGGAGTCGCTGGGTATCAAGCAC
GAGGAAGCCCCTGGCCACAGGCCCACCACCAACCCCAATGCATCCAAATTTGCCCAGAAGATTGGTGGC
TCCGAGCGCTGCCCCCGATGCAGCCAGGCAGTCTATGCTGCGGAGAAGGTGATTGGTGCTGGGAAGGGA
TTATTTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001144773
Insert Size 423 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001144773.1
RefSeq Size 1960 bp
RefSeq ORF 423 bp
Locus ID 1465
MW 15 kDa
Gene Summary This gene encodes a member of the cysteine-rich protein (CSRP) family. This gene family includes a group of LIM domain proteins, which may be involved in regulatory processes important for development and cellular differentiation. The LIM/double zinc-finger motif found in this gene product occurs in proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2010]
Transcript Variant: This variant (2) uses a different alternate exon for its 3' coding region and UTR, compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct C-terminus when it is compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...