United States
Germany
Japan
United Kingdom
China
COX4NB (EMC8) (NM_001142288) Human Untagged Clone
CAT＃: SC325486
EMC8 (untagged)-Human COX4 neighbor (COX4NB), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C16orf2; C16orf4; COX4NB; FAM158B; NOC4 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001142288, the custom clone sequence may differ by one or more nucleotides
ATGCCCGGGGTGAAACTGACCACCCAGGCCTACTGCAAGATGGTGCTGCACGGCGCCAAG TACCCGCACTGCGCCGTCAACGGGCTCCTGGTGGCCGAGAAGCAGAAGCCGCGTAAGGAG CACCTCCCCCTGGGCGGCCCCGGCGCCCACCACACCCTCTTCGTGGACTGCATCCCCCTC TTCCACGGCACCCTGGCCCTCGCCCCCATGCTGGAGGTGGCTCTCACCCTGATTGATTCA TGGTGCAAAGATCATAGCTACGTGATTGCTGGTTATTATCAAGCTAATGAGCGAGTAAAG GATGCCAGTCCAAACCAGGTTGCAGAGAAGGTGGCCTCCAGAATCGCCGAGGGCTTCAGC GACACTGCGCTCATCATG |
| Restriction Sites | Please inquire |
| ACCN | NM_001142288 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001142288.1, NP_001135760.1 |
| RefSeq Size | 1869 bp |
| RefSeq ORF | 381 bp |
| Locus ID | 10328 |
| UniProt ID | O43402 |
| Gene Summary | Part of the endoplasmic reticulum membrane protein complex (EMC) that enables the energy-independent insertion into endoplasmic reticulum membranes of newly synthesized membrane proteins (PubMed:30415835, PubMed:29809151, PubMed:29242231, PubMed:32459176, PubMed:32439656). Preferentially accommodates proteins with transmembrane domains that are weakly hydrophobic or contain destabilizing features such as charged and aromatic residues (PubMed:30415835, PubMed:29809151, PubMed:29242231). Involved in the cotranslational insertion of multi-pass membrane proteins in which stop-transfer membrane-anchor sequences become ER membrane spanning helices (PubMed:30415835, PubMed:29809151). It is also required for the post-translational insertion of tail-anchored/TA proteins in endoplasmic reticulum membranes (PubMed:29809151, PubMed:29242231). By mediating the proper cotranslational insertion of N-terminal transmembrane domains in an N-exo topology, with translocated N-terminus in the lumen of the ER, controls the topology of multi-pass membrane proteins like the G protein-coupled receptors (PubMed:30415835). By regulating the insertion of various proteins in membranes, it is indirectly involved in many cellular processes (Probable).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227584 | EMC8 (Myc-DDK-tagged)-Human COX4 neighbor (COX4NB), transcript variant 2 |
CNY 3,990.00 |
|
| RC227584L3 | Lenti-ORF clone of EMC8 (Myc-DDK-tagged)-Human COX4 neighbor (COX4NB), transcript variant 2 |
CNY 5,890.00 |
|
| RC227584L4 | Lenti-ORF clone of EMC8 (mGFP-tagged)-Human COX4 neighbor (COX4NB), transcript variant 2 |
CNY 5,890.00 |
|
| RG227584 | EMC8 (tGFP-tagged) - Human COX4 neighbor (COX4NB), transcript variant 2 |
CNY 4,370.00 |
