IL18BP (NM_001145055) Human Untagged Clone
CAT#: SC325474
IL18BP (untagged)-Human interleukin 18 binding protein (IL18BP), transcript variant H
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FVH; IL18BPa |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001145055, the custom clone sequence may differ by one or more nucleotides
ATGACCATGAGACACAACTGGACACCAGACCTCAGCCCTTTGTGGGTCCTGCTCCTGTGT GCCCACGTCGTCACTCTCCTGGTCAGAGCCACACCTGTCTCGCAGACCACCACAGCTGCC ACTGCCTCAGTTAGAAGCACAAAGGACCCCTGCCCCTCCCAGCCCCCAGTGTTCCCAGCA GCTAAGCAGTGTCCAGCATTGGAAGTGACCTGGCCAGAGGTGGAAGTGCCACTGAGCTGG GCTGAGGGCAACCTTGCCCCCCACCCAAGAAGCCCTGCCCTCCAGCCACAGCAGTCCACA GCAGCAGGGTTAAGACTCAGCACAGGGCCAGCAGCAGCACAACCT |
Restriction Sites | Please inquire |
ACCN | NM_001145055 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145055.1, NP_001138527.1 |
RefSeq Size | 1053 bp |
RefSeq ORF | 348 bp |
Locus ID | 10068 |
UniProt ID | O95998 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | The protein encoded by this gene functions as an inhibitor of the proinflammatory cytokine, IL18. It binds IL18, prevents the binding of IL18 to its receptor, and thus inhibits IL18-induced IFN-gamma production, resulting in reduced T-helper type 1 immune responses. This protein is constitutively expressed and secreted in mononuclear cells. Elevated level of this protein is detected in the intestinal tissues of patients with Crohn's disease. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (H) lacks two internal exons in the 3' coding region compared to variant A, which results in a frame-shift and a shorter isoform (b, also known as IL-18BPb) with a distinct C-terminus compared to isoform a. This isoform lacks the ability to bind IL-18 (PMID:10655506). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227245 | IL18BP (Myc-DDK-tagged)-Human interleukin 18 binding protein (IL18BP), transcript variant H |
CNY 3,990.00 |
|
RC227245L3 | Lenti-ORF clone of IL18BP (Myc-DDK-tagged)-Human interleukin 18 binding protein (IL18BP), transcript variant H |
CNY 5,890.00 |
|
RC227245L4 | Lenti-ORF clone of IL18BP (mGFP-tagged)-Human interleukin 18 binding protein (IL18BP), transcript variant H |
CNY 5,890.00 |
|
RG227245 | IL18BP (tGFP-tagged) - Human interleukin 18 binding protein (IL18BP), transcript variant H |
CNY 4,370.00 |