FAIM3 (FCMR) (NM_001142472) Human Untagged Clone
CAT#: SC325033
FAIM3 (untagged)-Human Fas apoptotic inhibitory molecule 3 (FAIM3), transcript variant 2
CNY 7,220.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Fas apoptotic inhibitory molecule 3; OTTHUMP00000034619; regulator of Fas-induced apoptosis; TOSO |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001142472, the custom clone sequence may differ by one or more nucleotides
ATGGACTTCTGGCTTTGGCCACTTTACTTCCTGCCAGTATCGGGGGCCCTGAGGATCCTCCCAGAAGTAA AGGTAGAGGGGGAGCTGGGCGGATCAGTTACCATCAAGTGCCCACTTCCTGAAATGCATGTGAGGATATA TCTGTGCCGGGAGATGGCTGGATCTGGAACATGTGGTACCGTGGTATCCACCACCAACTTCATCAAGGCA GAATACAAGGGCCGAGTTACTCTGAAGCAATACCCACGCAAGAATCTGTTCCTAGTGGAGGTAACACAGC TGACAGAAAGTGACAGCGGAGTCTATGCCTGCGGAGCGGGCATGAACACAGACCGGGGAAAGACCCAGAA AGTCACCCTGAATGTCCACAGTGAATACGAGCCATCATGGGAAGAGCAGCCAATGCCTGAGACTCCAAAA TGGTTTCATCTGCCCTATTTGTTCCAGATGCCTGCATATGCCAGTTCTTCCAAATTCGTAACCAGAGTTA CCACACCAGCTCAAAGGGGCAAGGTCCCTCCAGTTCACCACTCCTCCCCCACCACCCAAATCACCCACCG CCCTCGAGTGTCCAGAGCATCTTCAGTAGCAGGTGACAAGCCCCGAACCTTCCTGCCATCCACTACAGCC TCAAAAATCTCAGCTCTGGAGGGGCTGCTCAAGCCCCAGACGCCCAGCTACAACCACCACACCAGGCTGC ACAGGCAGAGAGCACTGGACTATGGCTCACAGTCTGGGAGGGAAGGCCAAGGATTTCACATCCTGATCCC GACCATCCTGGGCCTTTTCCTGCTGGCACTTCTGGGGCTGGTGGTGAAAAGGGCCGTTGAAAGGAGGAAA GCCCTCTCCAGGCGGGCCCGCCGACTGGCCGTGAGGATGCGCGCCCTGGAGAGCTCCCAGAGGCCCCGCG GGTCGCCGCGACCGCGCTCCCAAAACAACATCTACAGCGCCTGCCCGCGGCGCGCTCGTGGAGCGGACGC TGCAGGCACAGGGGAGGCCCCCGTTCCCGGCCCCGGAGCGCCGTTGCCCCCCGCCCCGCTGCAGGTGTCT GAATCTCCCTGGCTCCATGCCCCATCTCTGAAGACCAGCTGTGAATACGTGAGCCTCTACCACCAGCCTG CCGCCATGATGGAGGACAGTGATTCAGATGACTACATCAATGTTCCTGCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001142472 |
Insert Size | 1900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001142472.1, NP_001135944.1 |
RefSeq Size | 3067 bp |
RefSeq ORF | 1173 bp |
Locus ID | 9214 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | Fc receptors specifically bind to the Fc region of immunoglobulins (Igs) to mediate the unique functions of each Ig class. FAIM3 encodes an Fc receptor for IgM (see MIM 147020) (Kubagawa et al., 2009 [PubMed 19858324]; Shima et al., 2010 [PubMed 20042454]).[supplied by OMIM, Jul 2010] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227937 | FAIM3 (Myc-DDK-tagged)-Human Fas apoptotic inhibitory molecule 3 (FAIM3), transcript variant 2 |
CNY 3,656.00 |
|
RC227937L1 | Lenti ORF clone of Human Fas apoptotic inhibitory molecule 3 (FAIM3), transcript variant 2, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC227937L2 | Lenti ORF clone of Human Fas apoptotic inhibitory molecule 3 (FAIM3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC227937L3 | Lenti ORF clone of Human Fas apoptotic inhibitory molecule 3 (FAIM3), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC227937L4 | Lenti ORF clone of Human Fas apoptotic inhibitory molecule 3 (FAIM3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG227937 | FAIM3 (tGFP-tagged) - Human Fas apoptotic inhibitory molecule 3 (FAIM3), transcript variant 2 |
CNY 4,370.00 |