Sphingomyelin Synthase 2 (SGMS2) (NM_001136257) Human Untagged Clone

CAT#: SC325000

SGMS2 (untagged)-Human sphingomyelin synthase 2 (SGMS2), transcript variant 2



  "NM_001136257" in other vectors (4)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SGMS2 Antibody
    • 50 ug

CNY 5,200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CDL; SMS2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325000 representing NM_001136257.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATATCATAGAGACAGCAAAACTTGAAGAACATTTGGAAAATCAACCCAGTGATCCTACGAACACT
TATGCAAGACCCGCTGAACCTGTTGAAGAAGAAAACAAAAATGGCAATGGTAAACCCAAGAGCTTATCC
AGTGGGCTGCGAAAAGGCACCAAAAAGTACCCGGACTATATCCAAATTGCTATGCCCACTGAATCAAGG
AACAAATTTCCACTAGAGTGGTGGAAAACGGGCATTGCCTTCATATATGCAGTTTTCAACCTCGTCTTG
ACAACCGTCATGATCACAGTTGTACATGAGAGGGTCCCTCCCAAGGAGCTTAGCCCTCCACTCCCAGAC
AAGTTTTTTGATTACATTGATAGGGTGAAATGGGCATTTTCTGTATCAGAAATAAATGGGATTATATTA
GTTGGATTATGGATCACCCAGTGGCTGTTTCTGAGATACAAGTCAATAGTGGGACGCAGATTCTGTTTT
ATTATTGGAACTTTATACCTGTATCGCTGCATTACAATGTATGTTACTACTCTACCTGTGCCTGGAATG
CATTTCCAGTGTGCTCCAAAGCTCAATGGAGACTCTCAGGCAAAAGTTCAACGGATTCTACGATTGATT
TCTGGTGGTGGATTGTCCATAACTGGATCACATATCTTATGTGGAGACTTCCTCTTCAGCGGTCACACG
GTTACGCTGACACTGACTTATTTGTTCATCAAAGAATATTCGCCTCGTCACTTCTGGTGGTATCATTTA
ATCTGCTGGCTGCTGAGTGCTGCCGGGATCATCTGCATTCTTGTAGCACACGAACACTACACTATCGAT
GTGATCATTGCTTATTATATCACAACACGACTGTTTTGGTGGTACCATTCAATGGCCAATGAAAAGAAC
TTGAAGGTCTCTTCACAGACTAATTTCTTATCTCGAGCATGGTGGTTCCCCATCTTTTATTTTTTTGAG
AAAAATGTACAAGGCTCAATTCCTTGCTGCTTCTCCTGGCCGCTGTCTTGGCCTCCTGGCTGCTTCAAA
TCATCATGCAAAAAGTATTCACGGGTTCAGAAGATTGGTGAAGACAATGAGAAATCGACCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001136257
Insert Size 1098 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001136257.1
RefSeq Size 5970 bp
RefSeq ORF 1098 bp
Locus ID 166929
UniProt ID Q8NHU3
Protein Families Druggable Genome, Transmembrane
Protein Pathways Metabolic pathways, Sphingolipid metabolism
MW 42.3 kDa
Gene Summary Sphingomyelin, a major component of cell and Golgi membranes, is made by the transfer of phosphocholine from phosphatidylcholine onto ceramide, with diacylglycerol as a side product. The protein encoded by this gene is an enzyme that catalyzes this reaction primarily at the cell membrane. The synthesis is reversible, and this enzyme can catalyze the reaction in either direction. The encoded protein is required for cell growth. Three transcript variants encoding the same protein have been found for this gene. There is evidence for more variants, but the full-length nature of their transcripts has not been determined.[provided by RefSeq, Oct 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All three variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...