DOK3 (NM_001144875) Human Untagged Clone

CAT#: SC324947

DOK3 (untagged)-Human docking protein 3 (DOK3), transcript variant 2



  "NM_001144875" in other vectors (4)

CNY 6,270.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


DOK3 mouse monoclonal antibody,clone OTI3G9
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DOKL
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001144875, the custom clone sequence may differ by one or more nucleotides
ATGGACCCTCTGGAGACCCCTATCAAGGATGGCATCCTCTACCAGCAGCATGTCAAGTTT
GGCAAGAAGTGCTGGCGGAAGGTGTGGGCTCTGCTGTATGCAGGAGGCCCATCAGGCGTG
GCACGGCTGGAGAGCTGGGAGGTCCGGGATGGTGGCCTGGGAGCAGCGGGTGACAGGTCG
GCAGGGCCTGGCCGGCGAGGGGAGCGACGGGTCATCCGCCTGGCTGACTGTGTGTCCGTG
CTGCCGGCTGACGGCGAGAGCTGCCCCCGGGACACCGGTGCCTTCCTGCTCACCACCACC
GAGCGAAGCCATCTACTGGCTGCTCAGCACCGCCAGGCCTGGATGGGCCCCATCTGCCAG
CTGGCCTTCCCGGGGACAGGGGAGGCCTCCTCAGGATCCACAGATGCCCAGTCTCCCAAG
AGGGGCCTGGTCCCCATGGAGGAAAACTCCATCTACTCCTCCTGGCAGGAAGTGGGCGAG
TTTCCCGTGGTGGTGCAGAGGACTGAGGCCGCCACCCGCTGCCAGCTGAAGGGGCCGGCC
CTGCTGGTGCTGGGCCCAGACGCCATCCAGCTGAGGGAGGCCAAGGGCACCCAGGCCCTC
TACAGCTGGCCCTACCACTTCCTGCGCAAGTTCGGCTCCGACAAGATACTTCTGGGAACC
CCAGGCGTCAGTCTCCTCATCTGTAAAGGAGAGAGAACCGATGACGTATCAGGCATAATC
CTTGATGAGAGTTTGCTGCGTGCCTACTCAGTGCCAGGCGCTGGGGGACACAGCCGTGTT
CAGGACAGCCTTGGTCCTGTTCTCCGGGAGCCGACATTCCAGGGGGAGAGAAGTTTCCTG
AAGACTTCCATGCTGCGTTCCCTCCTCTGCTCCTGCTCCTGGCGCCATCCTAGGAGCCAG
CCACGCACGCAAGCGTCATGCCTCCAGGGCTCTGACTGCCCAGCCCCTCACCGCAACTCC
ACCTCAGCTGCACACACCCTTGGCACATCC
Restriction Sites Please inquire     
ACCN NM_001144875
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001144875.1, NP_001138347.1
RefSeq Size 2354 bp
RefSeq ORF 993 bp
Locus ID 79930
UniProt ID Q7L591
Protein Families Druggable Genome
Gene Summary DOK proteins are enzymatically inert adaptor or scaffolding proteins. They provide a docking platform for the assembly of multimolecular signaling complexes. DOK3 is a negative regulator of JNK signaling in B-cells through interaction with INPP5D/SHIP1. May modulate ABL1 function (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) contains alternate 5' exon structure and an alternate 3' terminal exon, and it thus initiates translation at a downstream in-frame start codon, and differs in both UTRs and the 3' coding region, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...