ITPK1 (NM_001142594) Human Untagged Clone
CAT#: SC324930
ITPK1 (untagged)-Human inositol-tetrakisphosphate 1-kinase (ITPK1), transcript variant 3
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ITRPK1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001142594, the custom clone sequence may differ by one or more nucleotides
ATGCAGACCTTTCTGAAAGGGAAGAGAGTTGGCTACTGGCTGAGCGAGAAGAAAATCAAG AAGCTGAATTTCCAGGCCTTCGCCGAGCTGTGCAGGAAGCGAGGGATGGAGGTTGTGCAG CTGAACCTTAGCCGGCCGATCGAGGAGCAGGGCCCCCTGGACGTCATCATCCACAAGCTG ACTGACGTCATCCTTGAAGCCGACCAGAATGATAGCCAGTCCCTGGAGCTGGTGCACAGG TTCCAGGAGTACATCGATGCCCACCCTGAGACCATCGTCCTGGACCCGCTCCCTGCCATC AGAACCCTGCTTGACCGCTCCAAGTCCTATGAGCTCATCCGGAAGATTGAGGCCTACATG GAAGACGACAGGATCTGCTCGCCACCCTTCATGGAGCTCACGAGCCTGTGCGGGGATGAC ACCATGCGGCTGCTGGAGAAGAACGGCTTGACTTTCCCATTCATTTGCAAAACCAGAGTG GCTCATGGCACCAACTCTCACGAGATGGCTATCGTGTTCAACCAGGAGGGCCTGAACGCC ATCCAGCCACCCTGCGTGGTCCAGAATTTCATCAACCACAACGCCGTCCTGTACAAGGTG TTCGTGGTTGGCGAGTCCTACACCGTGGTCCAGAGGCCCTCACTCAAGAACTTCTCCGCA GGCACATCAGACCGTGAGTCCATCTTCTTCAACAGCCACAACGTGTCAAAGCCGGAGTCG TCATCGGTCCTGACGGAGCTGGACAAGATCGAGGGCGTGTTCGAGCGGCCGAGCGACGAG GTCATCCGGGAGCTCTCCCGGGCCCTGCGGCAGGCACTGGGCGTGTCACTCTTCGGCATC GACATCATCATCAACAACCAGACAGGGCAGCACGCCGTCATTGACATCAATGCCTTCCCA GGGGACTGCCAAGTGTGCTTTATAGAAGGCTGGAAGACCGAC |
Restriction Sites | Please inquire |
ACCN | NM_001142594 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001142594.1, NP_001136066.1 |
RefSeq Size | 2821 bp |
RefSeq ORF | 945 bp |
Locus ID | 3705 |
UniProt ID | Q13572 |
Protein Families | Druggable Genome |
Protein Pathways | Inositol phosphate metabolism, Metabolic pathways, Phosphatidylinositol signaling system |
Gene Summary | This gene encodes an enzyme that belongs to the inositol 1,3,4-trisphosphate 5/6-kinase family. This enzyme regulates the synthesis of inositol tetraphosphate, and downstream products, inositol pentakisphosphate and inositol hexakisphosphate. Inositol metabolism plays a role in the development of the neural tube. Disruptions in this gene are thought to be associated with neural tube defects. A pseudogene of this gene has been identified on chromosome X. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (3) uses an alternate splice pattern in the 3' coding region, compared to variant 1. The resulting isoform (b) has a shorter and distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227538 | ITPK1 (Myc-DDK-tagged)-Human inositol-tetrakisphosphate 1-kinase (ITPK1), transcript variant 3 |
CNY 3,990.00 |
|
RC227538L3 | Lenti-ORF clone of ITPK1 (Myc-DDK-tagged)-Human inositol-tetrakisphosphate 1-kinase (ITPK1), transcript variant 3 |
CNY 5,890.00 |
|
RC227538L4 | Lenti-ORF clone of ITPK1 (mGFP-tagged)-Human inositol-tetrakisphosphate 1-kinase (ITPK1), transcript variant 3 |
CNY 5,890.00 |
|
RG227538 | ITPK1 (tGFP-tagged) - Human inositol-tetrakisphosphate 1-kinase (ITPK1), transcript variant 3 |
CNY 4,370.00 |