ECSIT (NM_001142464) Human Untagged Clone
CAT#: SC324905
ECSIT (untagged)-Human ECSIT homolog (Drosophila) (ECSIT), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SITPEC |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001142464, the custom clone sequence may differ by one or more nucleotides
ATGAGCTGGGTCCAGGCCACCCTACTGGCCCGAGGCCTCTGTAGGGCCTGGGGAGGCACC TGCGGGGCCGCCCTCACAGGAACCTCCATCTCTCAGGTCCCTCGCCGGCTCCCTCGGGGC CTCCACTGCAGCGCAGCTGCCCATAGCTCTGAACAGTCCCTGGTTCCCAGCCCACCGGAA CCCCGGCAGAGGCCCACCAAGGCTCTGGTGCCCTTTGAGGACCTGTTTGGGCAGGCGCCT GGTGGGGAACGGGACAAGGCGAGCTTCCTGCAGACGGTGCAGAAATTTGCGGAGCACAGC GTGCGTAAGCGGGGCCACATTGACTTCATCTACCTGGCCCTGCGCAAGATGCGGGAGTAT GGTGTCGAGCGGGACCTGGCTGTGTACAACCAGCTGCTCAACATCTTCCCCAAGGAGGTC TTCCGGCCTCGCAACATCATCCAGCGCATCTTCGTCCACTACCCTCGGCAGCAGGAGTGT GGGATTGCTGTCCTGGAGCAGATGGAGAACCACGGTGTGATGCCCAACAAGGAGACGGAG TTCCTGCTGATTCAGATCTTTGGACGCAAAAGCTACCCCATGCTCAAGTTGGTGCGCCTG AAGCTGTGGTTCCCTCGATTCATGAACGTCAACCCCTTCCCAGTGCCCCGGGACCTGCCC CAGGACCCTGTGGAGCTGGCCATGTTTGGCCTGCGGCACATGGAGCCTGACCTTAGTGCC AGGGTCACCATCTACCAGGTTCCTTTGCCCAAAGACTCAACAGGTGCAGCAGATCCCCCC CAGCCCCACATCGTAGGAAGTGGAAGAGACGCCGGAGGAGTGGAACCTCTACTACCCGAT GCAGCTGGACCTGGAGTATGTGAGGAGTGGCTGGGACAACTACGAGTT |
Restriction Sites | Please inquire |
ACCN | NM_001142464 |
Insert Size | 1561 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001142464.1, NP_001135936.1 |
RefSeq Size | 1561 bp |
RefSeq ORF | 891 bp |
Locus ID | 51295 |
UniProt ID | Q9BQ95 |
Protein Pathways | MAPK signaling pathway |
Gene Summary | Adapter protein of the Toll-like and IL-1 receptor signaling pathway that is involved in the activation of NF-kappa-B via MAP3K1. Promotes proteolytic activation of MAP3K1. Involved in the BMP signaling pathway. Required for normal embryonic development (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227591 | ECSIT (Myc-DDK-tagged)-Human ECSIT homolog (Drosophila) (ECSIT), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 3,990.00 |
|
RC227591L3 | Lenti-ORF clone of ECSIT (Myc-DDK-tagged)-Human ECSIT homolog (Drosophila) (ECSIT), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
RC227591L4 | Lenti-ORF clone of ECSIT (mGFP-tagged)-Human ECSIT homolog (Drosophila) (ECSIT), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
RG227591 | ECSIT (tGFP-tagged) - Human ECSIT homolog (Drosophila) (ECSIT), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4,370.00 |