NR2F2 (NM_001145156) Human Untagged Clone
CAT#: SC324861
NR2F2 (untagged)-Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 3
CNY 3,990.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARP-1; ARP1; CHTD4; COUPTF2; COUPTFB; COUPTFII; NF-E3; SRXX5; SVP40; TFCOUP2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001145156, the custom clone sequence may differ by one or more nucleotides
ATGCCGCCGACCCAGCCGACCCACGGGCAGTTCGCGCTGACCAACGGGGATCCCCTCAAC TGCCACTCGTACCTGTCCGGATATATTTCCCTGCTGTTGCGCGCGGAGCCCTATCCCACG TCGCGCTTCGGCAGCCAATGCATGCAGCCCAACAACATCATGGGTATCGAGAACATTTGC GAACTGGCCGCGAGGATGCTCTTCAGCGCCGTCGAGTGGGCCCGGAACATCCCCTTCTTC CCCGACCTGCAGATCACGGACCAGGTGGCCCTGCTTCGCCTCACCTGGAGCGAGCTGTTT GTGTTGAATGCGGCGCAGTGCTCCATGCCCCTCCACGTCGCCCCGCTCCTGGCCGCCGCC GGCCTGCATGCTTCGCCCATGTCCGCCGACCGGGTGGTCGCCTTTATGGACCACATACGG ATCTTCCAAGAGCAAGTGGAGAAGCTCAAGGCGCTGCACGTTGACTCAGCCGAGTACAGC TGCCTCAAGGCCATAGTCCTGTTCACCTCAGATGCCTGTGGTCTCTCTGATGTAGCCCAT GTGGAAAGCTTGCAGGAAAAGTCTCAGTGTGCTTTGGAAGAATACGTTAGGAGCCAGTAC CCCAACCAGCCGACGAGATTCGGAAAGCTTTTGCTTCGCCTCCCTTCCCTCCGCACCGTC TCCTCCTCAGTCATAGAGCAATTGTTTTTCGTCCGTTTGGTAGGTAAAACCCCCATCGAA ACCCTCATCCGGGATATGTTACTGTCCGGCAGCAGTTTTAACTGGCCGTATATGGCAATT CAA |
Restriction Sites | Please inquire |
ACCN | NM_001145156 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001145156.1, NP_001138628.1 |
RefSeq Size | 3501 bp |
RefSeq ORF | 786 bp |
Locus ID | 7026 |
UniProt ID | P24468 |
Protein Families | Druggable Genome, Nuclear Hormone Receptor, Transcription Factors |
Gene Summary | This gene encodes a member of the steroid thyroid hormone superfamily of nuclear receptors. The encoded protein is a ligand inducible transcription factor that is involved in the regulation of many different genes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010] Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (c) is shorter at the N-terminus compared to isoform a. Variants 3 and 4 both encode isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
The nuclear hormone receptor Coup-TFII is required for the initiation and early maintenance of Prox1 expression in lymphatic endothelial cells
,R. Sathish Srinivasan, Xin Geng, Ying Yang, Yingdi Wang, Suraj Mukatira, Michèle Studer, Marianna P.R. Porto, Oleg Lagutin, and Guillermo Oliver,
Genes & Dev., Apr 2010; 24: 696 - 707
[NR2F2]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226714 | NR2F2 (Myc-DDK-tagged)-Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 3 |
CNY 4,180.00 |
|
RC226714L3 | Lenti-ORF clone of NR2F2 (Myc-DDK-tagged)-Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 3 |
CNY 6,080.00 |
|
RC226714L4 | Lenti-ORF clone of NR2F2 (mGFP-tagged)-Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 3 |
CNY 6,424.00 |
|
RG226714 | NR2F2 (tGFP-tagged) - Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 3 |
CNY 4,560.00 |