DULLARD (CTDNEP1) (NM_001143775) Human Untagged Clone
CAT#: SC324830
CTDNEP1 (untagged)-Human CTD nuclear envelope phosphatase 1 (CTDNEP1), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DULLARD; HSA011916; NET56 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324830 representing NM_001143775.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATGCGGACGCAGTGTCTGCTGGGGCTGCGCACGTTCGTGGCCTTCGCCGCCAAGCTCTGGAGCTTC TTCATTTACCTTCTGCGGAGGCAGATCCGCACGGTAATTCAGTACCAAACTGTTCGATATGATATCCTC CCCTTATCTCCTGTGTCCCGGAATCGGCTAGCCCAGGTGAAGAGGAAGATCCTGGTGCTGGATCTGGAT GAGACACTTATTCACTCCCACCATGATGGGGTCCTGAGGCCCACAGTCCGGCCTGGTACGCCTCCTGAC TTCATCCTCAAGGTGGTAATAGACAAACATCCTGTCCGGTTTTTTGTACATAAGAGGCCCCATGTGGAT TTCTTCCTGGAAGTGGTGAGCCAGTGGTACGAGCTGGTGGTGTTTACAGCAAGCATGGAGATCTATGGC TCTGCTGTGGCAGATAAACTGGACAATAGCAGAAGCATTCTTAAGAGGAGATATTACAGACAGCACTGC ACTTTGGAGTTGGGCAGCTACATCAAGGACCTCTCTGTGGTCCACAGTGACCTCTCCAGCATTGTGATC CTGGATAACTCCCCAGGGGCTTACAGGAGCCATCCAGACAATGCCATCCCCATCAAATCCTGGTTCAGT GACCCCAGCGACACAGCCCTTCTCAACCTGCTCCCAATGCTGGATGCCCTCAGGTTCACCGCTGATGTT CGTTCCGTGCTGAGCCGAAACCTTCACCAACATCGGCTCTGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001143775 |
Insert Size | 735 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001143775.1 |
RefSeq Size | 1713 bp |
RefSeq ORF | 735 bp |
Locus ID | 23399 |
UniProt ID | O95476 |
Protein Families | Transmembrane |
MW | 28.4 kDa |
Gene Summary | Serine/threonine protein phosphatase forming with CNEP1R1 an active phosphatase complex that dephosphorylates and may activate LPIN1 and LPIN2. LPIN1 and LPIN2 are phosphatidate phosphatases that catalyze the conversion of phosphatidic acid to diacylglycerol and control the metabolism of fatty acids at different levels. May indirectly modulate the lipid composition of nuclear and/or endoplasmic reticulum membranes and be required for proper nuclear membrane morphology and/or dynamics. May also indirectly regulate the production of lipid droplets and triacylglycerol. May antagonize BMP signaling.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227230 | CTDNEP1 (Myc-DDK-tagged)-Human CTD nuclear envelope phosphatase 1 (CTDNEP1), transcript variant 2 |
CNY 2,400.00 |
|
RC227230L1 | Lenti ORF clone of Human CTD nuclear envelope phosphatase 1 (CTDNEP1), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC227230L2 | Lenti ORF clone of Human CTD nuclear envelope phosphatase 1 (CTDNEP1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC227230L3 | Lenti ORF clone of Human CTD nuclear envelope phosphatase 1 (CTDNEP1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC227230L4 | Lenti ORF clone of Human CTD nuclear envelope phosphatase 1 (CTDNEP1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG227230 | CTDNEP1 (tGFP-tagged) - Human CTD nuclear envelope phosphatase 1 (CTDNEP1), transcript variant 2 |
CNY 4,370.00 |
其它DULLARD产品