Apg10 (ATG10) (NM_001131028) Human Untagged Clone

CAT#: SC324798

ATG10 (untagged)-Human ATG10 autophagy related 10 homolog (S. cerevisiae) (ATG10), transcript variant 3



  "NM_001131028" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
ATG10 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms APG10; APG10L; pp12616
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC324798 representing NM_001131028.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAGAAGATGAGTTCATTGGAGAAAAAACATTCCAACGTTATTGTGCAGAATTCATTAAACATTCA
CAACAGATAGGTGATAGTTGGGAATGGAGACCATCAAAGGACTGTTCTGATGGCTACATGTGCAAAATA
CACTTTCAAATTAAGAATGGGTCTGTGATGTCACATCTAGGAGCATCTACCCATGGACAGACATGTCTT
CCCATGGAGGAGGCTTTCGAGCTACCCTTGGATGATTGTGAAGTGATTGAAACTGCAGCAGCGTCCGAA
GTGATTAAATATGAGTATCATGTCTTATATTCCTGTAGCTACCAAGTGCCTGTACTTTACTTTAGGGCA
AGCTTTTTAGATGGGAGACCTTTAACTCTGAAGGACATATGGGAAGGAGTTCATGAGTGCTATAAGATG
CGACTGCTACAGGGACCATGGGACACTATTACGCAACAGGAACATCCAATACTTGGGCAACCCTTTTTT
GTACTTCATCCCTGCAAGACGAATGAATTCATGACTCCTGTATTAAAGAATTCTCAGAAAATCAATAAG
AATGTCAACTATATCACATCATGGCTGAGCATTGTAGGGCCAGTTGTTGGGCTGAATCTACCTCTGAGT
TATGCCAAAGCAACGTCTCAGGATGAACGAAATGTCCCTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001131028
Insert Size 663 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001131028.1
RefSeq Size 2432 bp
RefSeq ORF 663 bp
Locus ID 83734
UniProt ID Q9H0Y0
MW 25.3 kDa
Gene Summary Autophagy is a process for the bulk degradation of cytosolic compartments by lysosomes. ATG10 is an E2-like enzyme involved in 2 ubiquitin-like modifications essential for autophagosome formation: ATG12 (MIM 609608)-ATG5 (MIM 604261) conjugation and modification of a soluble form of MAP-LC3 (MAP1LC3A; MIM 601242), a homolog of yeast Apg8, to a membrane-bound form (Nemoto et al., 2003 [PubMed 12890687]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (1) is the longer transcript. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...