Apg10 (ATG10) (NM_001131028) Human Untagged Clone
CAT#: SC324798
ATG10 (untagged)-Human ATG10 autophagy related 10 homolog (S. cerevisiae) (ATG10), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | APG10; APG10L; pp12616 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324798 representing NM_001131028.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAAGAAGATGAGTTCATTGGAGAAAAAACATTCCAACGTTATTGTGCAGAATTCATTAAACATTCA CAACAGATAGGTGATAGTTGGGAATGGAGACCATCAAAGGACTGTTCTGATGGCTACATGTGCAAAATA CACTTTCAAATTAAGAATGGGTCTGTGATGTCACATCTAGGAGCATCTACCCATGGACAGACATGTCTT CCCATGGAGGAGGCTTTCGAGCTACCCTTGGATGATTGTGAAGTGATTGAAACTGCAGCAGCGTCCGAA GTGATTAAATATGAGTATCATGTCTTATATTCCTGTAGCTACCAAGTGCCTGTACTTTACTTTAGGGCA AGCTTTTTAGATGGGAGACCTTTAACTCTGAAGGACATATGGGAAGGAGTTCATGAGTGCTATAAGATG CGACTGCTACAGGGACCATGGGACACTATTACGCAACAGGAACATCCAATACTTGGGCAACCCTTTTTT GTACTTCATCCCTGCAAGACGAATGAATTCATGACTCCTGTATTAAAGAATTCTCAGAAAATCAATAAG AATGTCAACTATATCACATCATGGCTGAGCATTGTAGGGCCAGTTGTTGGGCTGAATCTACCTCTGAGT TATGCCAAAGCAACGTCTCAGGATGAACGAAATGTCCCTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001131028 |
Insert Size | 663 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001131028.1 |
RefSeq Size | 2432 bp |
RefSeq ORF | 663 bp |
Locus ID | 83734 |
UniProt ID | Q9H0Y0 |
MW | 25.3 kDa |
Gene Summary | Autophagy is a process for the bulk degradation of cytosolic compartments by lysosomes. ATG10 is an E2-like enzyme involved in 2 ubiquitin-like modifications essential for autophagosome formation: ATG12 (MIM 609608)-ATG5 (MIM 604261) conjugation and modification of a soluble form of MAP-LC3 (MAP1LC3A; MIM 601242), a homolog of yeast Apg8, to a membrane-bound form (Nemoto et al., 2003 [PubMed 12890687]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (1) is the longer transcript. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225262 | ATG10 (Myc-DDK-tagged)-Human ATG10 autophagy related 10 homolog (S. cerevisiae) (ATG10), transcript variant 3 |
CNY 2,400.00 |
|
RC225262L3 | Lenti ORF clone of Human ATG10 autophagy related 10 homolog (S. cerevisiae) (ATG10), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225262L4 | Lenti ORF clone of Human ATG10 autophagy related 10 homolog (S. cerevisiae) (ATG10), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG225262 | ATG10 (tGFP-tagged) - Human ATG10 autophagy related 10 homolog (S. cerevisiae) (ATG10), transcript variant 3 |
CNY 4,370.00 |