HMGB2 (NM_001130689) Human Untagged Clone

CAT#: SC324789

HMGB2 (untagged)-Human high mobility group box 2 (HMGB2), transcript variant 3



  "NM_001130689" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-HMGB2 Antibody
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HMG2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC324789 representing NM_001130689.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGTAAAGGAGACCCCAACAAGCCGCGGGGCAAAATGTCCTCGTACGCCTTCTTCGTGCAGACCTGC
CGGGAAGAGCACAAGAAGAAACACCCGGACTCTTCCGTCAATTTCGCGGAATTCTCCAAGAAGTGTTCG
GAGAGATGGAAGACCATGTCTGCAAAGGAGAAGTCGAAGTTTGAAGATATGGCAAAAAGTGACAAAGCT
CGCTATGACAGGGAGATGAAAAATTACGTTCCTCCCAAAGGTGATAAGAAGGGGAAGAAAAAGGACCCC
AATGCTCCTAAAAGGCCACCATCTGCCTTCTTCCTGTTTTGCTCTGAACATCGCCCAAAGATCAAAAGT
GAACACCCTGGCCTATCCATTGGGGATACTGCAAAGAAATTGGGTGAAATGTGGTCTGAGCAGTCAGCC
AAAGATAAACAACCATATGAACAGAAAGCAGCTAAGCTAAAGGAGAAATATGAAAAGGATATTGCTGCA
TATCGTGCCAAGGGCAAAAGTGAAGCAGGAAAGAAGGGCCCTGGCAGGCCAACAGGCTCAAAGAAGAAG
AACGAACCAGAAGATGAGGAGGAGGAGGAGGAAGAAGAAGATGAAGATGAGGAGGAAGAGGATGAAGAT
GAAGAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001130689
Insert Size 630 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001130689.1
RefSeq Size 1454 bp
RefSeq ORF 630 bp
Locus ID 3148
UniProt ID P26583
Protein Families Druggable Genome, Transcription Factors
MW 24 kDa
Gene Summary This gene encodes a member of the non-histone chromosomal high mobility group protein family. The proteins of this family are chromatin-associated and ubiquitously distributed in the nucleus of higher eukaryotic cells. In vitro studies have demonstrated that this protein is able to efficiently bend DNA and form DNA circles. These studies suggest a role in facilitating cooperative interactions between cis-acting proteins by promoting DNA flexibility. This protein was also reported to be involved in the final ligation step in DNA end-joining processes of DNA double-strand breaks repair and V(D)J recombination. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...